Incidental Mutation 'R1475:Usp50'
ID163980
Institutional Source Beutler Lab
Gene Symbol Usp50
Ensembl Gene ENSMUSG00000027364
Gene Nameubiquitin specific peptidase 50
Synonyms
MMRRC Submission 039528-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1475 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location126709096-126783470 bp(-) (GRCm38)
Type of Mutationsplice site (4 bp from exon)
DNA Base Change (assembly) T to C at 126769867 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028842] [ENSMUST00000130356] [ENSMUST00000136319]
Predicted Effect probably null
Transcript: ENSMUST00000028842
SMART Domains Protein: ENSMUSP00000028842
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 44 360 9.2e-67 PFAM
Pfam:UCH_1 45 342 2.8e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000130356
SMART Domains Protein: ENSMUSP00000116873
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 8 183 1.5e-20 PFAM
Pfam:UCH_1 22 194 3.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136319
SMART Domains Protein: ENSMUSP00000121578
Gene: ENSMUSG00000027364

DomainStartEndE-ValueType
Pfam:UCH 1 268 1.9e-39 PFAM
Pfam:UCH_1 1 269 1.3e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145194
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A T 8: 121,540,588 probably benign Het
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cdk11b G A 4: 155,634,217 R208H probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dffa T A 4: 149,117,478 L171Q probably damaging Het
Emcn C T 3: 137,379,907 H89Y possibly damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Il23r C A 6: 67,452,296 probably null Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Nmnat2 G A 1: 153,074,695 R42H probably damaging Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Olfr901 T A 9: 38,430,864 V194D probably benign Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Plekhm2 T C 4: 141,627,854 D954G possibly damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in Usp50
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Usp50 APN 2 126709414 missense probably damaging 0.98
IGL01565:Usp50 APN 2 126777968 nonsense probably null
IGL01976:Usp50 APN 2 126709466 missense probably benign 0.10
IGL02192:Usp50 APN 2 126778038 missense possibly damaging 0.94
IGL02272:Usp50 APN 2 126769944 missense probably damaging 0.98
IGL02892:Usp50 APN 2 126769902 missense probably damaging 1.00
PIT4453001:Usp50 UTSW 2 126783316 start gained probably benign
R0034:Usp50 UTSW 2 126777975 missense possibly damaging 0.89
R0382:Usp50 UTSW 2 126777928 missense probably damaging 1.00
R0433:Usp50 UTSW 2 126761544 missense probably damaging 0.98
R1146:Usp50 UTSW 2 126709472 missense probably benign 0.02
R1457:Usp50 UTSW 2 126761634 missense probably benign 0.41
R1758:Usp50 UTSW 2 126775862 missense probably damaging 1.00
R1889:Usp50 UTSW 2 126777898 critical splice donor site probably null
R1940:Usp50 UTSW 2 126778023 missense probably benign 0.03
R1959:Usp50 UTSW 2 126777961 missense possibly damaging 0.91
R2698:Usp50 UTSW 2 126778029 missense probably damaging 0.97
R4648:Usp50 UTSW 2 126778033 missense probably damaging 0.98
R4809:Usp50 UTSW 2 126777853 intron probably benign
R6247:Usp50 UTSW 2 126775793 missense probably benign 0.33
R7030:Usp50 UTSW 2 126780475 missense possibly damaging 0.78
R7186:Usp50 UTSW 2 126783298 start gained probably benign
R7522:Usp50 UTSW 2 126783226 missense probably damaging 1.00
X0064:Usp50 UTSW 2 126761646 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCATGGAGTCTCGGAACTGTTAG -3'
(R):5'- AATGTGTTCAGGCGTGTGGACC -3'

Sequencing Primer
(F):5'- CTCGGAACTGTTAGTACCTAGTGTG -3'
(R):5'- TCGAGGCTTACAGACATCCTG -3'
Posted On2014-03-28