Incidental Mutation 'R1475:Emcn'
ID163983
Institutional Source Beutler Lab
Gene Symbol Emcn
Ensembl Gene ENSMUSG00000054690
Gene Nameendomucin
Synonyms0610012K22Rik
MMRRC Submission 039528-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1475 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location137341067-137432185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 137379907 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 89 (H89Y)
Ref Sequence ENSEMBL: ENSMUSP00000142467 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119475] [ENSMUST00000122064] [ENSMUST00000197511]
Predicted Effect possibly damaging
Transcript: ENSMUST00000119475
AA Change: H89Y

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000114102
Gene: ENSMUSG00000054690
AA Change: H89Y

DomainStartEndE-ValueType
Pfam:Endomucin 1 248 5.2e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122064
AA Change: H89Y

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112603
Gene: ENSMUSG00000054690
AA Change: H89Y

DomainStartEndE-ValueType
Pfam:Endomucin 1 261 4e-112 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128985
Predicted Effect possibly damaging
Transcript: ENSMUST00000197511
AA Change: H89Y

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142467
Gene: ENSMUSG00000054690
AA Change: H89Y

DomainStartEndE-ValueType
Pfam:Endomucin 1 92 1.3e-38 PFAM
Pfam:Endomucin 89 219 4.8e-80 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] EMCN is a mucin-like sialoglycoprotein that interferes with the assembly of focal adhesion complexes and inhibits interaction between cells and the extracellular matrix (Kinoshita et al., 2001 [PubMed 11418125]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A T 8: 121,540,588 probably benign Het
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cdk11b G A 4: 155,634,217 R208H probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dffa T A 4: 149,117,478 L171Q probably damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Il23r C A 6: 67,452,296 probably null Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Nmnat2 G A 1: 153,074,695 R42H probably damaging Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Olfr901 T A 9: 38,430,864 V194D probably benign Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Plekhm2 T C 4: 141,627,854 D954G possibly damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Usp50 T C 2: 126,769,867 probably null Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in Emcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00817:Emcn APN 3 137379877 missense probably benign 0.11
IGL02250:Emcn APN 3 137418986 splice site probably benign
IGL03035:Emcn APN 3 137372851 critical splice donor site probably null
R0101:Emcn UTSW 3 137341240 start codon destroyed possibly damaging 0.51
R0180:Emcn UTSW 3 137418994 critical splice acceptor site probably null
R0329:Emcn UTSW 3 137416814 splice site probably benign
R0348:Emcn UTSW 3 137372847 nonsense probably null
R2224:Emcn UTSW 3 137404017 missense possibly damaging 0.93
R2226:Emcn UTSW 3 137404017 missense possibly damaging 0.93
R2227:Emcn UTSW 3 137404017 missense possibly damaging 0.93
R2471:Emcn UTSW 3 137404011 missense probably damaging 1.00
R4057:Emcn UTSW 3 137379899 missense probably damaging 0.98
R4456:Emcn UTSW 3 137379847 nonsense probably null
R4823:Emcn UTSW 3 137423426 missense probably damaging 1.00
R5043:Emcn UTSW 3 137391601 missense possibly damaging 0.95
R5326:Emcn UTSW 3 137379877 missense probably benign 0.11
R5542:Emcn UTSW 3 137379877 missense probably benign 0.11
R6925:Emcn UTSW 3 137419002 missense probably damaging 0.99
R7137:Emcn UTSW 3 137403991 missense probably damaging 0.98
R7148:Emcn UTSW 3 137417094 missense possibly damaging 0.95
R7265:Emcn UTSW 3 137417078 missense probably damaging 0.97
R7265:Emcn UTSW 3 137419076 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCAATGCAGTAGTCTGCAATAGAAACT -3'
(R):5'- TGCTCTAACACCACCTAATGAGGCTAA -3'

Sequencing Primer
(F):5'- GTAGTCTGCAATAGAAACTTGCTG -3'
(R):5'- atgtcatttctcactgctgttc -3'
Posted On2014-03-28