Incidental Mutation 'R1475:Plekhm2'
ID163986
Institutional Source Beutler Lab
Gene Symbol Plekhm2
Ensembl Gene ENSMUSG00000028917
Gene Namepleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms2310034J19Rik
MMRRC Submission 039528-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1475 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location141625734-141664899 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141627854 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 954 (D954G)
Ref Sequence ENSEMBL: ENSMUSP00000081221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030751] [ENSMUST00000038661] [ENSMUST00000084203]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030751
AA Change: D934G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030751
Gene: ENSMUSG00000028917
AA Change: D934G

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 230 246 N/A INTRINSIC
low complexity region 295 307 N/A INTRINSIC
low complexity region 459 469 N/A INTRINSIC
low complexity region 485 495 N/A INTRINSIC
low complexity region 505 538 N/A INTRINSIC
Blast:PH 596 656 7e-31 BLAST
PH 766 869 2.43e-12 SMART
Blast:PH 879 960 6e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000038661
SMART Domains Protein: ENSMUSP00000039188
Gene: ENSMUSG00000040740

DomainStartEndE-ValueType
Pfam:Mito_carr 16 111 2.2e-14 PFAM
Pfam:Mito_carr 113 213 7.6e-18 PFAM
Pfam:Mito_carr 217 314 9.3e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000084203
AA Change: D954G

PolyPhen 2 Score 0.754 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000081221
Gene: ENSMUSG00000028917
AA Change: D954G

DomainStartEndE-ValueType
RUN 93 156 3.18e-21 SMART
low complexity region 250 266 N/A INTRINSIC
low complexity region 315 327 N/A INTRINSIC
low complexity region 479 489 N/A INTRINSIC
low complexity region 505 515 N/A INTRINSIC
low complexity region 525 558 N/A INTRINSIC
Blast:PH 616 676 7e-31 BLAST
PH 786 889 2.43e-12 SMART
Blast:PH 899 980 6e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136102
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150229
Meta Mutation Damage Score 0.2773 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds the plus-end directed microtubule motor protein kinesin, together with the lysosomal GTPase Arl8, and is required for lysosomes to distribute away from the microtubule-organizing center. The encoded protein belongs to the multisubunit BLOC-one-related complex that regulates lysosome positioning. It binds a Salmonella effector protein called Salmonella induced filament A and is a critical host determinant in Salmonella pathogenesis. It has a domain architecture consisting of an N-terminal RPIP8, UNC-14, and NESCA (RUN) domain that binds kinesin-1 as well as the lysosomal GTPase Arl8, and a C-terminal pleckstrin homology domain that binds the Salmonella induced filament A effector protein. Naturally occurring mutations in this gene lead to abnormal localization of lysosomes, impaired autophagy flux and are associated with recessive dilated cardiomyopathy and left ventricular noncompaction. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased leukocyte numbers and decreased susceptibility to Salmonella infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A T 8: 121,540,588 probably benign Het
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cdk11b G A 4: 155,634,217 R208H probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dffa T A 4: 149,117,478 L171Q probably damaging Het
Emcn C T 3: 137,379,907 H89Y possibly damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Il23r C A 6: 67,452,296 probably null Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Nmnat2 G A 1: 153,074,695 R42H probably damaging Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Olfr901 T A 9: 38,430,864 V194D probably benign Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Usp50 T C 2: 126,769,867 probably null Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in Plekhm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Plekhm2 APN 4 141642645 splice site probably null
IGL01388:Plekhm2 APN 4 141642001 missense probably damaging 1.00
IGL01392:Plekhm2 APN 4 141642426 missense probably damaging 0.98
IGL01482:Plekhm2 APN 4 141630029 missense probably damaging 0.98
IGL01828:Plekhm2 APN 4 141629585 missense probably benign 0.11
IGL02010:Plekhm2 APN 4 141637419 splice site probably benign
IGL02075:Plekhm2 APN 4 141628306 missense probably benign 0.38
IGL02381:Plekhm2 APN 4 141642723 missense possibly damaging 0.95
IGL02543:Plekhm2 APN 4 141642019 missense probably benign 0.02
IGL02747:Plekhm2 APN 4 141634272 missense possibly damaging 0.55
IGL02802:Plekhm2 APN 4 141642524 splice site probably benign
IGL02828:Plekhm2 APN 4 141629630 missense probably damaging 1.00
IGL03286:Plekhm2 APN 4 141634347 missense possibly damaging 0.95
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0008:Plekhm2 UTSW 4 141642393 splice site probably benign
R0639:Plekhm2 UTSW 4 141642070 missense probably damaging 1.00
R0682:Plekhm2 UTSW 4 141628125 missense probably damaging 0.97
R0968:Plekhm2 UTSW 4 141629932 missense probably benign 0.01
R1109:Plekhm2 UTSW 4 141627984 missense probably benign 0.31
R1802:Plekhm2 UTSW 4 141634347 missense probably benign 0.03
R1813:Plekhm2 UTSW 4 141642439 missense possibly damaging 0.93
R1844:Plekhm2 UTSW 4 141632374 missense probably benign
R2261:Plekhm2 UTSW 4 141642732 missense probably damaging 0.98
R3889:Plekhm2 UTSW 4 141641990 splice site probably benign
R3922:Plekhm2 UTSW 4 141629532 missense probably benign 0.01
R4324:Plekhm2 UTSW 4 141631857 missense possibly damaging 0.86
R4758:Plekhm2 UTSW 4 141642005 missense possibly damaging 0.91
R4814:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R4983:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R5468:Plekhm2 UTSW 4 141628100 missense probably damaging 1.00
R5691:Plekhm2 UTSW 4 141628289 missense possibly damaging 0.96
R5877:Plekhm2 UTSW 4 141639693 missense probably damaging 0.98
R6268:Plekhm2 UTSW 4 141632341 nonsense probably null
R6367:Plekhm2 UTSW 4 141639705 missense probably damaging 0.97
R6371:Plekhm2 UTSW 4 141629532 missense possibly damaging 0.94
R6489:Plekhm2 UTSW 4 141632033 missense probably damaging 1.00
R7266:Plekhm2 UTSW 4 141642459 missense possibly damaging 0.91
R7399:Plekhm2 UTSW 4 141634376 missense probably damaging 1.00
R7573:Plekhm2 UTSW 4 141631347 missense probably benign 0.02
R7742:Plekhm2 UTSW 4 141627839 missense probably benign 0.00
R7864:Plekhm2 UTSW 4 141628046 missense probably damaging 0.96
R7920:Plekhm2 UTSW 4 141632121 missense probably damaging 1.00
R8417:Plekhm2 UTSW 4 141627825 missense probably benign 0.04
R8504:Plekhm2 UTSW 4 141642453 missense probably damaging 1.00
T0722:Plekhm2 UTSW 4 141631981 small deletion probably benign
T0975:Plekhm2 UTSW 4 141631981 small deletion probably benign
X0024:Plekhm2 UTSW 4 141628041 missense probably damaging 1.00
Z1177:Plekhm2 UTSW 4 141629085 missense possibly damaging 0.77
Z1177:Plekhm2 UTSW 4 141639822 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- ACCCTTCAGACTTACGTCTCACCAG -3'
(R):5'- GGATTGCCAAACCAGCTTCTTTCG -3'

Sequencing Primer
(F):5'- GGCCCAAAGTTTCTGACTATCTAAAG -3'
(R):5'- TTTCGCTCCCTGGGCAC -3'
Posted On2014-03-28