Incidental Mutation 'R1475:Dffa'
ID163989
Institutional Source Beutler Lab
Gene Symbol Dffa
Ensembl Gene ENSMUSG00000028974
Gene NameDNA fragmentation factor, alpha subunit
SynonymsICAD-L, A330085O09Rik, ICAD-S, DFF35, Dff45
MMRRC Submission 039528-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R1475 (G1)
Quality Score131
Status Validated
Chromosome4
Chromosomal Location149104146-149120647 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149117478 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 171 (L171Q)
Ref Sequence ENSEMBL: ENSMUSP00000099505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030816] [ENSMUST00000103216]
Predicted Effect probably damaging
Transcript: ENSMUST00000030816
AA Change: L171Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030816
Gene: ENSMUSG00000028974
AA Change: L171Q

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 1.1e-74 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000103216
AA Change: L171Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099505
Gene: ENSMUSG00000028974
AA Change: L171Q

DomainStartEndE-ValueType
CAD 19 94 1.79e-47 SMART
Pfam:DFF-C 100 264 2.2e-80 PFAM
Meta Mutation Damage Score 0.8086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is a cell death process that removes toxic and/or useless cells during mammalian development. The apoptotic process is accompanied by shrinkage and fragmentation of the cells and nuclei and degradation of the chromosomal DNA into nucleosomal units. DNA fragmentation factor (DFF) is a heterodimeric protein of 40-kD (DFFB) and 45-kD (DFFA) subunits. DFFA is the substrate for caspase-3 and triggers DNA fragmentation during apoptosis. DFF becomes activated when DFFA is cleaved by caspase-3. The cleaved fragments of DFFA dissociate from DFFB, the active component of DFF. DFFB has been found to trigger both DNA fragmentation and chromatin condensation during apoptosis. Two alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show increased resistance to apoptosis in response to several apoptotic stimuli, enhanced spatial learning and memory, higher granule cell density and total granule cell number in the dentate gyrus, and resistance to kainic acid-induced CA3 neuronal cell death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A T 8: 121,540,588 probably benign Het
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cdk11b G A 4: 155,634,217 R208H probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Emcn C T 3: 137,379,907 H89Y possibly damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Il23r C A 6: 67,452,296 probably null Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Nmnat2 G A 1: 153,074,695 R42H probably damaging Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Olfr901 T A 9: 38,430,864 V194D probably benign Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Plekhm2 T C 4: 141,627,854 D954G possibly damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Usp50 T C 2: 126,769,867 probably null Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in Dffa
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1672:Dffa UTSW 4 149106245 missense probably damaging 1.00
R1950:Dffa UTSW 4 149104382 missense probably benign 0.05
R3856:Dffa UTSW 4 149104251 start codon destroyed possibly damaging 0.62
R5185:Dffa UTSW 4 149117430 missense probably benign 0.04
R5238:Dffa UTSW 4 149104303 missense probably benign 0.04
R5280:Dffa UTSW 4 149117934 missense probably benign 0.00
R5514:Dffa UTSW 4 149106315 critical splice donor site probably null
X0065:Dffa UTSW 4 149119131 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACGGAGCTGAATTTCTAAGGAGGC -3'
(R):5'- CTGCAATGTAAATGAGACAGCAGGC -3'

Sequencing Primer
(F):5'- GAGCTGAATTTCTAAGGAGGCTTAAC -3'
(R):5'- CTAGGGACTGTCATCAGGATACTG -3'
Posted On2014-03-28