Incidental Mutation 'R1475:Olfr901'
ID164002
Institutional Source Beutler Lab
Gene Symbol Olfr901
Ensembl Gene ENSMUSG00000052058
Gene Nameolfactory receptor 901
SynonymsGA_x6K02T2PVTD-32123032-32123967, MOR162-8
MMRRC Submission 039528-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R1475 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38429455-38432682 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 38430864 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 194 (V194D)
Ref Sequence ENSEMBL: ENSMUSP00000150506 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063716] [ENSMUST00000216502] [ENSMUST00000216644]
Predicted Effect probably benign
Transcript: ENSMUST00000063716
AA Change: V194D

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000066714
Gene: ENSMUSG00000052058
AA Change: V194D

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 4.2e-47 PFAM
Pfam:7tm_1 42 290 3.2e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216502
AA Change: V194D

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000216644
AA Change: V194D

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (46/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700018B08Rik A T 8: 121,540,588 probably benign Het
9230112D13Rik T A 14: 34,512,055 D93V unknown Het
Aatk G A 11: 120,010,888 T894M probably damaging Het
Acacb T C 5: 114,195,252 I479T possibly damaging Het
Acap3 T C 4: 155,902,821 I431T probably damaging Het
Adgrl1 A G 8: 83,938,350 K1267R possibly damaging Het
Bphl A C 13: 34,060,524 D208A probably benign Het
C2cd5 T C 6: 143,072,572 D308G possibly damaging Het
Camsap3 C T 8: 3,604,708 R782C probably damaging Het
Cdk11b G A 4: 155,634,217 R208H probably damaging Het
Cfap44 T C 16: 44,433,812 probably benign Het
Chrna4 T C 2: 181,029,379 S195G probably benign Het
Cpsf2 T C 12: 101,985,236 L144S probably damaging Het
Creld2 G A 15: 88,820,631 W103* probably null Het
Dffa T A 4: 149,117,478 L171Q probably damaging Het
Emcn C T 3: 137,379,907 H89Y possibly damaging Het
Espn G A 4: 152,134,271 P452S probably damaging Het
Fam78b T A 1: 167,001,777 I71N probably damaging Het
Fam89b A G 19: 5,729,419 S37P probably damaging Het
Fat4 G A 3: 38,888,323 R455H probably damaging Het
Fbxo6 A G 4: 148,146,110 F232L probably benign Het
Fcamr T A 1: 130,814,484 probably null Het
Fermt3 T C 19: 7,018,874 probably null Het
Fsip2 A T 2: 82,987,195 D4424V probably damaging Het
Gaa G A 11: 119,274,316 probably null Het
Glce T C 9: 62,060,928 T314A possibly damaging Het
Hdac5 T C 11: 102,202,186 Q575R possibly damaging Het
Il23r C A 6: 67,452,296 probably null Het
Kcnj4 T A 15: 79,484,630 E383V probably damaging Het
Lrsam1 G T 2: 32,954,265 Q115K possibly damaging Het
Lyst T A 13: 13,708,212 probably null Het
Myf5 A G 10: 107,484,654 V190A probably benign Het
Nmnat2 G A 1: 153,074,695 R42H probably damaging Het
Olfr1051 A T 2: 86,275,561 *309R probably null Het
Osbpl1a T A 18: 12,757,680 K380M probably damaging Het
Pgd T C 4: 149,156,775 T226A probably benign Het
Pitpnm3 T C 11: 72,074,627 T127A probably damaging Het
Plekhm2 T C 4: 141,627,854 D954G possibly damaging Het
Pramef17 T C 4: 143,994,312 K20E probably benign Het
Rasal1 T A 5: 120,662,982 F236I possibly damaging Het
Stab1 T C 14: 31,163,828 N63S probably benign Het
Syf2 T A 4: 134,935,434 M145K possibly damaging Het
Usp34 C A 11: 23,473,253 L3152I probably damaging Het
Usp50 T C 2: 126,769,867 probably null Het
Wdfy4 A T 14: 33,108,688 I929N probably benign Het
Zfp874b A T 13: 67,474,092 probably null Het
Other mutations in Olfr901
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr901 APN 9 38430515 missense probably benign 0.20
IGL01875:Olfr901 APN 9 38430298 missense probably damaging 1.00
R0010:Olfr901 UTSW 9 38430920 missense possibly damaging 0.70
R1186:Olfr901 UTSW 9 38431101 missense possibly damaging 0.85
R1259:Olfr901 UTSW 9 38430873 missense probably damaging 0.99
R1273:Olfr901 UTSW 9 38430684 missense probably benign 0.05
R1530:Olfr901 UTSW 9 38430324 missense probably damaging 0.97
R1591:Olfr901 UTSW 9 38430411 missense probably damaging 1.00
R1750:Olfr901 UTSW 9 38430690 missense probably damaging 1.00
R1756:Olfr901 UTSW 9 38430995 missense probably benign
R2080:Olfr901 UTSW 9 38431082 missense probably benign 0.01
R3081:Olfr901 UTSW 9 38431056 missense possibly damaging 0.82
R4174:Olfr901 UTSW 9 38431020 missense probably damaging 0.97
R4299:Olfr901 UTSW 9 38430812 missense probably damaging 1.00
R4898:Olfr901 UTSW 9 38430815 missense probably benign 0.01
R5068:Olfr901 UTSW 9 38430464 missense probably damaging 1.00
R5695:Olfr901 UTSW 9 38431176 missense probably benign 0.01
R5973:Olfr901 UTSW 9 38430331 missense probably damaging 0.99
R6929:Olfr901 UTSW 9 38431148 missense probably benign 0.22
R8265:Olfr901 UTSW 9 38431173 missense probably damaging 0.99
R8321:Olfr901 UTSW 9 38430554 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCAATGACTCCACCACAGTGAAGG -3'
(R):5'- AACAGCTATTATGTGCGAGCTACAGG -3'

Sequencing Primer
(F):5'- TGCTGAGTGCATGACTCAAC -3'
(R):5'- CAGGTACTAATAGCCTTGGATCTGC -3'
Posted On2014-03-28