Incidental Mutation 'R1476:Ak1'
ID164030
Institutional Source Beutler Lab
Gene Symbol Ak1
Ensembl Gene ENSMUSG00000026817
Gene Nameadenylate kinase 1
SynonymsAk-1, B430205N08Rik
MMRRC Submission 039529-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R1476 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32621758-32635058 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32633466 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 166 (K166R)
Ref Sequence ENSEMBL: ENSMUSP00000108903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068271] [ENSMUST00000113277] [ENSMUST00000113278] [ENSMUST00000156578] [ENSMUST00000195721]
Predicted Effect probably benign
Transcript: ENSMUST00000068271
AA Change: K182R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000068479
Gene: ENSMUSG00000026817
AA Change: K182R

DomainStartEndE-ValueType
Pfam:AAA_33 26 173 2.7e-10 PFAM
Pfam:AAA_17 26 194 5.4e-8 PFAM
Pfam:ADK 29 185 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113277
AA Change: K166R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108902
Gene: ENSMUSG00000026817
AA Change: K166R

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113278
AA Change: K166R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108903
Gene: ENSMUSG00000026817
AA Change: K166R

DomainStartEndE-ValueType
Pfam:AAA_33 10 159 2.7e-10 PFAM
Pfam:AAA_17 10 171 5.4e-11 PFAM
Pfam:AAA_18 11 149 7.6e-8 PFAM
Pfam:ADK 13 169 7.5e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135392
Predicted Effect probably benign
Transcript: ENSMUST00000156578
SMART Domains Protein: ENSMUSP00000123534
Gene: ENSMUSG00000026817

DomainStartEndE-ValueType
Pfam:AAA_17 10 86 1.5e-10 PFAM
Pfam:ADK 13 89 3.5e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195721
SMART Domains Protein: ENSMUSP00000142174
Gene: ENSMUSG00000026817

DomainStartEndE-ValueType
Pfam:ADK 13 96 2e-32 PFAM
Meta Mutation Damage Score 0.0856 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an adenylate kinase enzyme involved in energy metabolism and homeostasis of cellular adenine nucleotide ratios in different intracellular compartments. This gene is highly expressed in skeletal muscle, brain and erythrocytes. Certain mutations in this gene resulting in a functionally inadequate enzyme are associated with a rare genetic disorder causing nonspherocytic hemolytic anemia. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased adenosine triphosphate (ATP) turnover and reduced efficiency of ATP utilization during muscle contraction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,702 probably benign Het
4932431P20Rik A G 7: 29,534,890 noncoding transcript Het
A730015C16Rik G A 4: 108,848,008 V40M probably damaging Het
Abcg2 A G 6: 58,678,337 D419G probably benign Het
Adamts17 A C 7: 67,075,343 E777A probably damaging Het
Ankrd12 T C 17: 65,986,305 K711R probably damaging Het
Ate1 A T 7: 130,418,571 probably null Het
Atp5a1 A G 18: 77,781,925 H519R probably benign Het
Best1 G T 19: 9,990,489 Y284* probably null Het
C2cd6 A G 1: 59,076,728 probably benign Het
Casz1 G T 4: 148,946,171 V1216L probably benign Het
Cdc42bpg A G 19: 6,313,782 D493G probably damaging Het
Ces2f A G 8: 104,952,502 D317G possibly damaging Het
Chst15 A T 7: 132,270,273 M93K possibly damaging Het
Cntnap5a T C 1: 115,901,020 L58P probably damaging Het
Crip3 T C 17: 46,430,776 probably benign Het
Csmd2 G A 4: 128,487,001 E2117K probably benign Het
Cstf3 A G 2: 104,648,219 D212G possibly damaging Het
Cttnbp2 T C 6: 18,434,221 K546R probably damaging Het
Cubn A G 2: 13,476,120 I308T probably benign Het
Cxcl9 T A 5: 92,325,113 D75V probably damaging Het
Dcdc5 C T 2: 106,358,632 noncoding transcript Het
Defa30 C A 8: 21,134,736 T25K possibly damaging Het
Dock7 A T 4: 99,079,435 H239Q possibly damaging Het
Dpp4 A G 2: 62,347,901 V629A possibly damaging Het
Fam83a T C 15: 58,009,945 M390T probably benign Het
Fem1c A G 18: 46,524,485 L54P probably damaging Het
Fntb T A 12: 76,910,233 M282K probably benign Het
Gm11099 G A 2: 58,859,470 probably benign Het
Gm1527 T C 3: 28,926,556 S602P probably benign Het
Gm20388 A G 8: 122,269,584 probably benign Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm7853 C A 14: 36,089,583 noncoding transcript Het
Gsta2 A T 9: 78,341,865 C18S probably benign Het
H1foo T C 6: 115,947,740 V69A possibly damaging Het
Hecw1 T C 13: 14,306,086 E465G probably damaging Het
Herc1 A G 9: 66,508,266 D4841G probably damaging Het
Hus1b A G 13: 30,947,001 V225A probably benign Het
Keg1 A T 19: 12,716,023 M137L probably benign Het
Kmt2a C T 9: 44,824,635 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mga T A 2: 119,941,675 V1672E probably damaging Het
Mios T C 6: 8,234,237 S803P probably benign Het
Mkl1 T C 15: 81,018,208 probably benign Het
Msh4 A T 3: 153,863,384 Y851N probably damaging Het
Mybl1 A C 1: 9,672,661 probably null Het
Myo5c A G 9: 75,275,939 Y865C probably damaging Het
Naip1 T C 13: 100,426,870 S596G probably benign Het
Nek5 G T 8: 22,096,731 Q355K possibly damaging Het
Nphp3 G T 9: 104,025,927 R701L possibly damaging Het
Olfr1006 T A 2: 85,674,918 T78S possibly damaging Het
Olfr1023 T A 2: 85,887,248 Y149* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1094 T C 2: 86,829,198 S149P probably benign Het
Olfr666 A T 7: 104,893,237 Y130* probably null Het
Palm A G 10: 79,815,187 N149D possibly damaging Het
Pot1b T C 17: 55,653,451 I626M possibly damaging Het
Ptprt T A 2: 161,927,484 D487V probably damaging Het
Qpct A G 17: 79,070,772 I124V probably benign Het
Rbm12b1 T A 4: 12,145,817 D596E possibly damaging Het
Rnf157 A G 11: 116,354,759 C277R probably damaging Het
Rnf169 A G 7: 99,925,328 S687P possibly damaging Het
Sfxn1 T A 13: 54,092,450 probably null Het
Slc6a21 T C 7: 45,272,628 V649A probably benign Het
Slit3 A T 11: 35,686,299 T1120S probably damaging Het
Spem2 A T 11: 69,818,070 M58K probably benign Het
Sprr2k T A 3: 92,433,396 probably benign Het
Sspo T C 6: 48,463,400 probably null Het
Sv2b A T 7: 75,120,043 F584I possibly damaging Het
Tkfc A T 19: 10,595,326 M317K probably null Het
Tnni3k C T 3: 155,030,305 G134S probably benign Het
Ttn C T 2: 76,739,780 R26923H probably damaging Het
Tuba3b T C 6: 145,618,453 V75A possibly damaging Het
Unc79 T C 12: 103,183,525 L2626P probably damaging Het
Usp24 A T 4: 106,361,933 I491F probably damaging Het
V1ra8 A T 6: 90,203,150 I112F probably damaging Het
Vmn1r29 T G 6: 58,307,678 F128V probably benign Het
Zfp157 T A 5: 138,455,095 probably null Het
Other mutations in Ak1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Ak1 APN 2 32633495 unclassified probably benign
R1472:Ak1 UTSW 2 32630301 missense probably damaging 1.00
R1876:Ak1 UTSW 2 32630270 missense probably damaging 0.99
R2004:Ak1 UTSW 2 32629610 missense probably benign
R4067:Ak1 UTSW 2 32629581 missense probably benign 0.05
R4246:Ak1 UTSW 2 32633372 missense possibly damaging 0.54
R4873:Ak1 UTSW 2 32631177 missense probably benign 0.28
R4875:Ak1 UTSW 2 32631177 missense probably benign 0.28
R5076:Ak1 UTSW 2 32633448 missense probably damaging 1.00
R6187:Ak1 UTSW 2 32633477 missense probably damaging 0.99
R6458:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6818:Ak1 UTSW 2 32630373 missense probably damaging 1.00
R6917:Ak1 UTSW 2 32631152 missense possibly damaging 0.86
R6919:Ak1 UTSW 2 32631122 missense possibly damaging 0.62
R8238:Ak1 UTSW 2 32633669 missense probably damaging 1.00
R8803:Ak1 UTSW 2 32633478 missense probably benign 0.28
Z1088:Ak1 UTSW 2 32630271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATCCGATTTCCACCCTACGCAG -3'
(R):5'- AGACCTCAGAGAAGACAGTGTCCAC -3'

Sequencing Primer
(F):5'- TACGCAGATTGGACAGCC -3'
(R):5'- AAGACAGTGTCCACCGTGC -3'
Posted On2014-03-28