Incidental Mutation 'R1476:Ptprt'
ID 164041
Institutional Source Beutler Lab
Gene Symbol Ptprt
Ensembl Gene ENSMUSG00000053141
Gene Name protein tyrosine phosphatase receptor type T
Synonyms RPTPrho
MMRRC Submission 039529-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1476 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 161363910-162503067 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 161769404 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 487 (D487V)
Ref Sequence ENSEMBL: ENSMUSP00000105068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109441] [ENSMUST00000109442] [ENSMUST00000109443] [ENSMUST00000109445]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109441
AA Change: D487V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105067
Gene: ENSMUSG00000053141
AA Change: D487V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1159 3.64e-129 SMART
PTPc 1188 1453 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109442
AA Change: D487V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105068
Gene: ENSMUSG00000053141
AA Change: D487V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 738 749 N/A INTRINSIC
transmembrane domain 772 791 N/A INTRINSIC
PTPc 901 1158 5.56e-134 SMART
PTPc 1187 1452 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109443
AA Change: D487V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105069
Gene: ENSMUSG00000053141
AA Change: D487V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
low complexity region 778 792 N/A INTRINSIC
PTPc 892 1149 5.56e-134 SMART
PTPc 1178 1443 4.24e-98 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000109445
AA Change: D487V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105071
Gene: ENSMUSG00000053141
AA Change: D487V

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
MAM 31 195 2.21e-71 SMART
IG 202 290 3.94e-2 SMART
FN3 292 375 3.35e-3 SMART
FN3 388 477 4.06e-2 SMART
FN3 489 579 1.2e-4 SMART
transmembrane domain 753 772 N/A INTRINSIC
PTPc 882 1139 5.56e-134 SMART
PTPc 1168 1433 4.24e-98 SMART
Meta Mutation Damage Score 0.3977 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP possesses an extracellular region, a single transmembrane region, and two tandem intracellular catalytic domains, and thus represents a receptor-type PTP. The extracellular region contains a meprin-A5 antigen-PTP (MAM) domain, Ig-like and fibronectin type III-like repeats. The protein domain structure and the expression pattern of the mouse counterpart of this PTP suggest its roles in both signal transduction and cellular adhesion in the central nervous system. Two alternatively spliced transcript variants of this gene, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are highly susceptible to carcinogen azoxymethane-induced colon tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,099,528 (GRCm39) probably benign Het
A730015C16Rik G A 4: 108,705,205 (GRCm39) V40M probably damaging Het
Abcg2 A G 6: 58,655,322 (GRCm39) D419G probably benign Het
Adamts17 A C 7: 66,725,091 (GRCm39) E777A probably damaging Het
Ak1 A G 2: 32,523,478 (GRCm39) K166R probably benign Het
Ankrd12 T C 17: 66,293,300 (GRCm39) K711R probably damaging Het
Ate1 A T 7: 130,020,301 (GRCm39) probably null Het
Atp5f1a A G 18: 77,869,625 (GRCm39) H519R probably benign Het
Best1 G T 19: 9,967,853 (GRCm39) Y284* probably null Het
C2cd6 A G 1: 59,115,887 (GRCm39) probably benign Het
Casz1 G T 4: 149,030,628 (GRCm39) V1216L probably benign Het
Cdc42bpg A G 19: 6,363,812 (GRCm39) D493G probably damaging Het
Ces2f A G 8: 105,679,134 (GRCm39) D317G possibly damaging Het
Chst15 A T 7: 131,872,002 (GRCm39) M93K possibly damaging Het
Cntnap5a T C 1: 115,828,750 (GRCm39) L58P probably damaging Het
Crip3 T C 17: 46,741,702 (GRCm39) probably benign Het
Csmd2 G A 4: 128,380,794 (GRCm39) E2117K probably benign Het
Cstf3 A G 2: 104,478,564 (GRCm39) D212G possibly damaging Het
Cttnbp2 T C 6: 18,434,220 (GRCm39) K546R probably damaging Het
Cubn A G 2: 13,480,931 (GRCm39) I308T probably benign Het
Cxcl9 T A 5: 92,472,972 (GRCm39) D75V probably damaging Het
Dcdc5 C T 2: 106,188,977 (GRCm39) noncoding transcript Het
Defa30 C A 8: 21,624,752 (GRCm39) T25K possibly damaging Het
Dock7 A T 4: 98,967,672 (GRCm39) H239Q possibly damaging Het
Dpp4 A G 2: 62,178,245 (GRCm39) V629A possibly damaging Het
Fam83a T C 15: 57,873,341 (GRCm39) M390T probably benign Het
Fem1c A G 18: 46,657,552 (GRCm39) L54P probably damaging Het
Fntb T A 12: 76,957,007 (GRCm39) M282K probably benign Het
Galnt2l A G 8: 122,996,323 (GRCm39) probably benign Het
Gm11099 G A 2: 58,749,482 (GRCm39) probably benign Het
Gm1527 T C 3: 28,980,705 (GRCm39) S602P probably benign Het
Gm5478 T A 15: 101,553,080 (GRCm39) I331F probably damaging Het
Gm7853 C A 14: 35,811,540 (GRCm39) noncoding transcript Het
Gsta2 A T 9: 78,249,147 (GRCm39) C18S probably benign Het
H1f8 T C 6: 115,924,701 (GRCm39) V69A possibly damaging Het
Hecw1 T C 13: 14,480,671 (GRCm39) E465G probably damaging Het
Herc1 A G 9: 66,415,548 (GRCm39) D4841G probably damaging Het
Hus1b A G 13: 31,130,984 (GRCm39) V225A probably benign Het
Keg1 A T 19: 12,693,387 (GRCm39) M137L probably benign Het
Kmt2a C T 9: 44,735,932 (GRCm39) probably benign Het
Megf6 G T 4: 154,261,578 (GRCm39) V68L probably benign Het
Mga T A 2: 119,772,156 (GRCm39) V1672E probably damaging Het
Mios T C 6: 8,234,237 (GRCm39) S803P probably benign Het
Mrtfa T C 15: 80,902,409 (GRCm39) probably benign Het
Msh4 A T 3: 153,569,021 (GRCm39) Y851N probably damaging Het
Mybl1 A C 1: 9,742,886 (GRCm39) probably null Het
Myo5c A G 9: 75,183,221 (GRCm39) Y865C probably damaging Het
Naip1 T C 13: 100,563,378 (GRCm39) S596G probably benign Het
Nek5 G T 8: 22,586,747 (GRCm39) Q355K possibly damaging Het
Nphp3 G T 9: 103,903,126 (GRCm39) R701L possibly damaging Het
Or52n2 A T 7: 104,542,444 (GRCm39) Y130* probably null Het
Or5j3 T C 2: 86,128,823 (GRCm39) I221T probably damaging Het
Or5m10 T A 2: 85,717,592 (GRCm39) Y149* probably null Het
Or5t9 T C 2: 86,659,542 (GRCm39) S149P probably benign Het
Or9g4 T A 2: 85,505,262 (GRCm39) T78S possibly damaging Het
Palm A G 10: 79,651,021 (GRCm39) N149D possibly damaging Het
Pot1b T C 17: 55,960,451 (GRCm39) I626M possibly damaging Het
Qpct A G 17: 79,378,201 (GRCm39) I124V probably benign Het
Rbm12b1 T A 4: 12,145,817 (GRCm39) D596E possibly damaging Het
Rnf157 A G 11: 116,245,585 (GRCm39) C277R probably damaging Het
Rnf169 A G 7: 99,574,535 (GRCm39) S687P possibly damaging Het
Sfxn1 T A 13: 54,246,469 (GRCm39) probably null Het
Slc6a21 T C 7: 44,922,052 (GRCm39) V649A probably benign Het
Slit3 A T 11: 35,577,126 (GRCm39) T1120S probably damaging Het
Spem2 A T 11: 69,708,896 (GRCm39) M58K probably benign Het
Sprr2k T A 3: 92,340,703 (GRCm39) probably benign Het
Sspo T C 6: 48,440,334 (GRCm39) probably null Het
Sv2b A T 7: 74,769,791 (GRCm39) F584I possibly damaging Het
Tkfc A T 19: 10,572,690 (GRCm39) M317K probably null Het
Tnni3k C T 3: 154,735,942 (GRCm39) G134S probably benign Het
Ttn C T 2: 76,570,124 (GRCm39) R26923H probably damaging Het
Tuba3b T C 6: 145,564,179 (GRCm39) V75A possibly damaging Het
Unc79 T C 12: 103,149,784 (GRCm39) L2626P probably damaging Het
Usp24 A T 4: 106,219,130 (GRCm39) I491F probably damaging Het
V1ra8 A T 6: 90,180,132 (GRCm39) I112F probably damaging Het
Vmn1r29 T G 6: 58,284,663 (GRCm39) F128V probably benign Het
Wdr87-ps A G 7: 29,234,315 (GRCm39) noncoding transcript Het
Zfp157 T A 5: 138,453,357 (GRCm39) probably null Het
Other mutations in Ptprt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Ptprt APN 2 161,652,544 (GRCm39) missense probably benign 0.00
IGL00565:Ptprt APN 2 161,402,111 (GRCm39) missense probably damaging 1.00
IGL00925:Ptprt APN 2 161,498,083 (GRCm39) missense possibly damaging 0.52
IGL01344:Ptprt APN 2 161,393,737 (GRCm39) missense probably damaging 1.00
IGL01432:Ptprt APN 2 162,109,999 (GRCm39) splice site probably benign
IGL02008:Ptprt APN 2 161,769,593 (GRCm39) missense probably benign 0.02
IGL02040:Ptprt APN 2 162,079,992 (GRCm39) missense probably damaging 1.00
IGL02172:Ptprt APN 2 161,397,422 (GRCm39) missense probably damaging 1.00
IGL02231:Ptprt APN 2 162,119,966 (GRCm39) critical splice donor site probably null
IGL02231:Ptprt APN 2 162,079,980 (GRCm39) missense probably damaging 1.00
IGL02232:Ptprt APN 2 161,372,437 (GRCm39) missense probably damaging 0.96
IGL02277:Ptprt APN 2 161,389,301 (GRCm39) missense probably damaging 1.00
IGL02447:Ptprt APN 2 162,120,027 (GRCm39) missense probably benign 0.01
IGL02601:Ptprt APN 2 161,608,227 (GRCm39) missense probably benign 0.10
IGL02623:Ptprt APN 2 161,449,372 (GRCm39) splice site probably benign
IGL03379:Ptprt APN 2 161,397,379 (GRCm39) nonsense probably null
Poverina UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
IGL03055:Ptprt UTSW 2 161,375,533 (GRCm39) missense probably damaging 0.96
R0064:Ptprt UTSW 2 161,769,711 (GRCm39) splice site probably benign
R0129:Ptprt UTSW 2 162,119,990 (GRCm39) missense probably benign 0.35
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0131:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0132:Ptprt UTSW 2 162,120,030 (GRCm39) missense probably benign 0.00
R0316:Ptprt UTSW 2 161,449,239 (GRCm39) missense probably damaging 1.00
R0454:Ptprt UTSW 2 161,395,742 (GRCm39) missense probably damaging 0.96
R0488:Ptprt UTSW 2 161,395,745 (GRCm39) missense probably damaging 0.99
R0573:Ptprt UTSW 2 161,393,668 (GRCm39) missense probably damaging 1.00
R0614:Ptprt UTSW 2 161,654,040 (GRCm39) missense possibly damaging 0.59
R0834:Ptprt UTSW 2 161,654,059 (GRCm39) splice site probably null
R1023:Ptprt UTSW 2 161,400,863 (GRCm39) missense probably damaging 1.00
R1184:Ptprt UTSW 2 161,769,692 (GRCm39) missense possibly damaging 0.82
R1253:Ptprt UTSW 2 162,120,146 (GRCm39) missense probably damaging 1.00
R1515:Ptprt UTSW 2 162,079,954 (GRCm39) missense probably damaging 1.00
R1595:Ptprt UTSW 2 161,652,469 (GRCm39) critical splice donor site probably null
R1939:Ptprt UTSW 2 161,769,560 (GRCm39) missense probably benign 0.45
R1987:Ptprt UTSW 2 161,608,241 (GRCm39) missense possibly damaging 0.48
R1987:Ptprt UTSW 2 161,400,818 (GRCm39) missense probably damaging 1.00
R2049:Ptprt UTSW 2 161,376,465 (GRCm39) missense probably damaging 1.00
R2140:Ptprt UTSW 2 161,653,908 (GRCm39) missense probably damaging 1.00
R2421:Ptprt UTSW 2 162,119,960 (GRCm39) splice site probably benign
R3432:Ptprt UTSW 2 161,769,449 (GRCm39) missense probably damaging 1.00
R3619:Ptprt UTSW 2 161,408,077 (GRCm39) missense probably damaging 1.00
R3757:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3758:Ptprt UTSW 2 161,653,950 (GRCm39) missense probably damaging 1.00
R3834:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3835:Ptprt UTSW 2 161,389,307 (GRCm39) missense probably damaging 1.00
R3915:Ptprt UTSW 2 161,397,475 (GRCm39) splice site probably benign
R4003:Ptprt UTSW 2 161,408,037 (GRCm39) splice site probably benign
R4387:Ptprt UTSW 2 161,769,570 (GRCm39) missense probably damaging 1.00
R4519:Ptprt UTSW 2 161,406,609 (GRCm39) missense probably damaging 1.00
R4618:Ptprt UTSW 2 161,395,765 (GRCm39) missense probably damaging 1.00
R4677:Ptprt UTSW 2 161,743,366 (GRCm39) critical splice donor site probably null
R4866:Ptprt UTSW 2 161,402,159 (GRCm39) missense probably damaging 1.00
R5088:Ptprt UTSW 2 162,080,095 (GRCm39) missense probably benign 0.01
R5173:Ptprt UTSW 2 161,769,676 (GRCm39) missense probably benign 0.01
R5215:Ptprt UTSW 2 162,120,084 (GRCm39) missense probably damaging 1.00
R5383:Ptprt UTSW 2 161,539,969 (GRCm39) missense probably damaging 1.00
R5398:Ptprt UTSW 2 161,769,512 (GRCm39) missense probably damaging 1.00
R5518:Ptprt UTSW 2 162,120,143 (GRCm39) missense probably damaging 0.99
R5711:Ptprt UTSW 2 161,652,524 (GRCm39) missense probably damaging 0.98
R5735:Ptprt UTSW 2 161,376,484 (GRCm39) missense probably damaging 0.98
R5834:Ptprt UTSW 2 161,402,189 (GRCm39) missense probably damaging 1.00
R5872:Ptprt UTSW 2 161,977,138 (GRCm39) missense probably damaging 1.00
R5926:Ptprt UTSW 2 161,406,606 (GRCm39) missense probably benign 0.00
R6210:Ptprt UTSW 2 162,109,949 (GRCm39) missense probably damaging 1.00
R6285:Ptprt UTSW 2 161,743,417 (GRCm39) missense possibly damaging 0.70
R6298:Ptprt UTSW 2 161,395,779 (GRCm39) missense probably damaging 1.00
R6406:Ptprt UTSW 2 161,395,703 (GRCm39) missense probably damaging 0.98
R6499:Ptprt UTSW 2 161,376,507 (GRCm39) missense probably benign 0.32
R6613:Ptprt UTSW 2 161,372,367 (GRCm39) missense probably damaging 1.00
R6622:Ptprt UTSW 2 161,395,760 (GRCm39) missense probably damaging 1.00
R7218:Ptprt UTSW 2 161,389,284 (GRCm39) missense probably damaging 1.00
R7247:Ptprt UTSW 2 161,375,443 (GRCm39) missense probably benign 0.15
R7576:Ptprt UTSW 2 161,449,225 (GRCm39) missense possibly damaging 0.88
R7733:Ptprt UTSW 2 161,417,707 (GRCm39) missense probably damaging 1.00
R7735:Ptprt UTSW 2 161,417,661 (GRCm39) missense probably damaging 1.00
R7813:Ptprt UTSW 2 161,372,413 (GRCm39) missense probably damaging 1.00
R8031:Ptprt UTSW 2 161,977,377 (GRCm39) missense probably damaging 1.00
R8074:Ptprt UTSW 2 161,769,581 (GRCm39) missense possibly damaging 0.77
R8151:Ptprt UTSW 2 162,120,005 (GRCm39) missense probably damaging 1.00
R8236:Ptprt UTSW 2 161,528,988 (GRCm39) critical splice donor site probably null
R8308:Ptprt UTSW 2 161,769,566 (GRCm39) missense probably benign 0.00
R8348:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8362:Ptprt UTSW 2 161,393,667 (GRCm39) missense probably damaging 1.00
R8365:Ptprt UTSW 2 161,743,451 (GRCm39) missense probably benign 0.05
R8448:Ptprt UTSW 2 161,400,806 (GRCm39) missense probably damaging 1.00
R8512:Ptprt UTSW 2 161,400,783 (GRCm39) missense probably benign 0.00
R8715:Ptprt UTSW 2 161,372,463 (GRCm39) missense probably damaging 1.00
R9004:Ptprt UTSW 2 161,608,314 (GRCm39) missense probably benign 0.04
R9046:Ptprt UTSW 2 161,372,361 (GRCm39) missense possibly damaging 0.58
R9222:Ptprt UTSW 2 161,402,106 (GRCm39) missense probably damaging 1.00
R9297:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9318:Ptprt UTSW 2 161,417,698 (GRCm39) missense probably benign
R9476:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9510:Ptprt UTSW 2 161,397,381 (GRCm39) missense probably damaging 1.00
R9571:Ptprt UTSW 2 161,395,732 (GRCm39) missense probably benign 0.10
X0064:Ptprt UTSW 2 161,769,403 (GRCm39) missense probably damaging 1.00
Z1088:Ptprt UTSW 2 162,080,041 (GRCm39) missense possibly damaging 0.86
Z1177:Ptprt UTSW 2 162,204,868 (GRCm39) missense possibly damaging 0.77
Z1177:Ptprt UTSW 2 161,574,807 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAATGGGGTCACCATGAGCACAT -3'
(R):5'- CAACCAGCAGCAGTATGAAGCTGA -3'

Sequencing Primer
(F):5'- aaaatggagaagagacttagaacac -3'
(R):5'- GAAGAGGTGATCCAGACATCTTCC -3'
Posted On 2014-03-28