Incidental Mutation 'R1476:Msh4'
ID164044
Institutional Source Beutler Lab
Gene Symbol Msh4
Ensembl Gene ENSMUSG00000005493
Gene NamemutS homolog 4
SynonymsmMsh4, 4930485C04Rik
MMRRC Submission 039529-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R1476 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location153857149-153906138 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 153863384 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 851 (Y851N)
Ref Sequence ENSEMBL: ENSMUSP00000005630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000188338] [ENSMUST00000190449]
Predicted Effect probably damaging
Transcript: ENSMUST00000005630
AA Change: Y851N

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493
AA Change: Y851N

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:MutS_II 177 321 2.3e-20 PFAM
MUTSd 352 679 3.77e-37 SMART
MUTSac 695 888 1.6e-81 SMART
Blast:MUTSac 912 956 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158139
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186220
Predicted Effect probably damaging
Transcript: ENSMUST00000188338
AA Change: Y763N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493
AA Change: Y763N

DomainStartEndE-ValueType
Pfam:MutS_II 89 233 5.3e-19 PFAM
MUTSd 264 591 9.4e-40 SMART
MUTSac 607 800 4.2e-84 SMART
Blast:MUTSac 808 866 4e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189189
Predicted Effect probably damaging
Transcript: ENSMUST00000190449
AA Change: Y657N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493
AA Change: Y657N

DomainStartEndE-ValueType
Pfam:MutS_II 1 127 3.3e-15 PFAM
MUTSd 158 485 9.4e-40 SMART
MUTSac 501 694 4.2e-84 SMART
Blast:MUTSac 702 760 5e-17 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191504
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191606
Meta Mutation Damage Score 0.4602 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair mutS family. This member is a meiosis-specific protein that is not involved in DNA mismatch correction, but is required for reciprocal recombination and proper segregation of homologous chromosomes at meiosis I. This protein and MSH5 form a heterodimer which binds uniquely to a Holliday Junction and its developmental progenitor, thus provoking ADP-ATP exchange, and stabilizing the interaction between parental chromosomes during meiosis double-stranded break repair. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit male and female sterility associated with failure to undergo pairing during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,702 probably benign Het
4932431P20Rik A G 7: 29,534,890 noncoding transcript Het
A730015C16Rik G A 4: 108,848,008 V40M probably damaging Het
Abcg2 A G 6: 58,678,337 D419G probably benign Het
Adamts17 A C 7: 67,075,343 E777A probably damaging Het
Ak1 A G 2: 32,633,466 K166R probably benign Het
Ankrd12 T C 17: 65,986,305 K711R probably damaging Het
Ate1 A T 7: 130,418,571 probably null Het
Atp5a1 A G 18: 77,781,925 H519R probably benign Het
Best1 G T 19: 9,990,489 Y284* probably null Het
C2cd6 A G 1: 59,076,728 probably benign Het
Casz1 G T 4: 148,946,171 V1216L probably benign Het
Cdc42bpg A G 19: 6,313,782 D493G probably damaging Het
Ces2f A G 8: 104,952,502 D317G possibly damaging Het
Chst15 A T 7: 132,270,273 M93K possibly damaging Het
Cntnap5a T C 1: 115,901,020 L58P probably damaging Het
Crip3 T C 17: 46,430,776 probably benign Het
Csmd2 G A 4: 128,487,001 E2117K probably benign Het
Cstf3 A G 2: 104,648,219 D212G possibly damaging Het
Cttnbp2 T C 6: 18,434,221 K546R probably damaging Het
Cubn A G 2: 13,476,120 I308T probably benign Het
Cxcl9 T A 5: 92,325,113 D75V probably damaging Het
Dcdc5 C T 2: 106,358,632 noncoding transcript Het
Defa30 C A 8: 21,134,736 T25K possibly damaging Het
Dock7 A T 4: 99,079,435 H239Q possibly damaging Het
Dpp4 A G 2: 62,347,901 V629A possibly damaging Het
Fam83a T C 15: 58,009,945 M390T probably benign Het
Fem1c A G 18: 46,524,485 L54P probably damaging Het
Fntb T A 12: 76,910,233 M282K probably benign Het
Gm11099 G A 2: 58,859,470 probably benign Het
Gm1527 T C 3: 28,926,556 S602P probably benign Het
Gm20388 A G 8: 122,269,584 probably benign Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm7853 C A 14: 36,089,583 noncoding transcript Het
Gsta2 A T 9: 78,341,865 C18S probably benign Het
H1foo T C 6: 115,947,740 V69A possibly damaging Het
Hecw1 T C 13: 14,306,086 E465G probably damaging Het
Herc1 A G 9: 66,508,266 D4841G probably damaging Het
Hus1b A G 13: 30,947,001 V225A probably benign Het
Keg1 A T 19: 12,716,023 M137L probably benign Het
Kmt2a C T 9: 44,824,635 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mga T A 2: 119,941,675 V1672E probably damaging Het
Mios T C 6: 8,234,237 S803P probably benign Het
Mkl1 T C 15: 81,018,208 probably benign Het
Mybl1 A C 1: 9,672,661 probably null Het
Myo5c A G 9: 75,275,939 Y865C probably damaging Het
Naip1 T C 13: 100,426,870 S596G probably benign Het
Nek5 G T 8: 22,096,731 Q355K possibly damaging Het
Nphp3 G T 9: 104,025,927 R701L possibly damaging Het
Olfr1006 T A 2: 85,674,918 T78S possibly damaging Het
Olfr1023 T A 2: 85,887,248 Y149* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1094 T C 2: 86,829,198 S149P probably benign Het
Olfr666 A T 7: 104,893,237 Y130* probably null Het
Palm A G 10: 79,815,187 N149D possibly damaging Het
Pot1b T C 17: 55,653,451 I626M possibly damaging Het
Ptprt T A 2: 161,927,484 D487V probably damaging Het
Qpct A G 17: 79,070,772 I124V probably benign Het
Rbm12b1 T A 4: 12,145,817 D596E possibly damaging Het
Rnf157 A G 11: 116,354,759 C277R probably damaging Het
Rnf169 A G 7: 99,925,328 S687P possibly damaging Het
Sfxn1 T A 13: 54,092,450 probably null Het
Slc6a21 T C 7: 45,272,628 V649A probably benign Het
Slit3 A T 11: 35,686,299 T1120S probably damaging Het
Spem2 A T 11: 69,818,070 M58K probably benign Het
Sprr2k T A 3: 92,433,396 probably benign Het
Sspo T C 6: 48,463,400 probably null Het
Sv2b A T 7: 75,120,043 F584I possibly damaging Het
Tkfc A T 19: 10,595,326 M317K probably null Het
Tnni3k C T 3: 155,030,305 G134S probably benign Het
Ttn C T 2: 76,739,780 R26923H probably damaging Het
Tuba3b T C 6: 145,618,453 V75A possibly damaging Het
Unc79 T C 12: 103,183,525 L2626P probably damaging Het
Usp24 A T 4: 106,361,933 I491F probably damaging Het
V1ra8 A T 6: 90,203,150 I112F probably damaging Het
Vmn1r29 T G 6: 58,307,678 F128V probably benign Het
Zfp157 T A 5: 138,455,095 probably null Het
Other mutations in Msh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Msh4 APN 3 153883735 missense possibly damaging 0.88
IGL01098:Msh4 APN 3 153877982 splice site probably benign
IGL01609:Msh4 APN 3 153897397 missense probably damaging 1.00
IGL01785:Msh4 APN 3 153857507 missense probably damaging 1.00
IGL01939:Msh4 APN 3 153857589 missense probably damaging 1.00
IGL02022:Msh4 APN 3 153886956 missense probably damaging 1.00
IGL02209:Msh4 APN 3 153888862 missense probably damaging 1.00
IGL02224:Msh4 APN 3 153890185 missense possibly damaging 0.94
IGL02240:Msh4 APN 3 153873674 missense probably damaging 0.98
IGL02493:Msh4 APN 3 153877908 critical splice donor site probably null
IGL02576:Msh4 APN 3 153867746 missense probably damaging 1.00
IGL02616:Msh4 APN 3 153857523 missense probably benign
IGL02812:Msh4 APN 3 153901400 splice site probably benign
IGL02888:Msh4 APN 3 153896913 nonsense probably null
IGL02992:Msh4 APN 3 153872325 missense possibly damaging 0.79
IGL03191:Msh4 APN 3 153869608 missense probably damaging 0.97
P0021:Msh4 UTSW 3 153888818 missense probably damaging 1.00
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0057:Msh4 UTSW 3 153869681 missense probably benign 0.16
R0368:Msh4 UTSW 3 153888825 missense probably damaging 1.00
R0377:Msh4 UTSW 3 153896890 missense probably benign 0.00
R0631:Msh4 UTSW 3 153866420 missense probably benign 0.02
R0632:Msh4 UTSW 3 153896895 missense probably damaging 1.00
R0677:Msh4 UTSW 3 153879367 missense possibly damaging 0.69
R0909:Msh4 UTSW 3 153863504 missense probably benign 0.00
R1081:Msh4 UTSW 3 153872358 missense probably benign 0.06
R1463:Msh4 UTSW 3 153857570 missense probably damaging 1.00
R1669:Msh4 UTSW 3 153876720 missense possibly damaging 0.47
R1733:Msh4 UTSW 3 153867767 missense probably damaging 1.00
R1859:Msh4 UTSW 3 153905880 missense probably benign
R2168:Msh4 UTSW 3 153867835 nonsense probably null
R2378:Msh4 UTSW 3 153863477 missense probably damaging 0.99
R2991:Msh4 UTSW 3 153905860 missense probably benign
R3025:Msh4 UTSW 3 153863491 missense probably damaging 1.00
R4604:Msh4 UTSW 3 153872283 missense probably damaging 1.00
R4757:Msh4 UTSW 3 153879387 missense probably damaging 0.99
R5205:Msh4 UTSW 3 153866412 missense probably damaging 1.00
R5285:Msh4 UTSW 3 153873713 missense probably benign 0.03
R5766:Msh4 UTSW 3 153867840 missense probably damaging 1.00
R5777:Msh4 UTSW 3 153863439 missense probably benign 0.01
R5888:Msh4 UTSW 3 153867723 critical splice donor site probably null
R7384:Msh4 UTSW 3 153888748 missense probably benign 0.23
R7408:Msh4 UTSW 3 153876745 missense probably benign 0.06
R7487:Msh4 UTSW 3 153863510 missense probably damaging 1.00
R7503:Msh4 UTSW 3 153867750 missense probably damaging 1.00
R7726:Msh4 UTSW 3 153866320 critical splice donor site probably null
R7990:Msh4 UTSW 3 153896892 missense probably damaging 1.00
R8097:Msh4 UTSW 3 153877908 critical splice donor site probably null
R8805:Msh4 UTSW 3 153857633 missense probably benign 0.00
R8814:Msh4 UTSW 3 153872320 missense probably damaging 1.00
R8861:Msh4 UTSW 3 153901468 missense probably benign 0.04
Z1177:Msh4 UTSW 3 153879368 missense probably benign 0.00
Z1177:Msh4 UTSW 3 153901443 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CAAGCCAATGTTTCCAGGGCTTTC -3'
(R):5'- CCCATGACCTGAACATGTCCATCTC -3'

Sequencing Primer
(F):5'- gtgatgtaatgtaatgtgatgtgatg -3'
(R):5'- GAACATGTCCATCTCTGAGATACTGG -3'
Posted On2014-03-28