Mutagenetix > Incidental Mutation

Incidental Mutation 'R1476:Usp24'

164048

Institutional Source

Beutler Lab

Gene Symbol

Usp24

Ensembl Gene

ENSMUSG00000028514

Gene Name

ubiquitin specific peptidase 24

Synonyms

2810030C21Rik, 2700066K03Rik

MMRRC Submission

039529-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1476 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

106316213-106441322 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 106361933 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 491 (I491F)

Ref Sequence

ENSEMBL: ENSMUSP00000133095 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000094933] [ENSMUST00000165709]

AlphaFold

B1AY13

Predicted Effect

probably damaging
Transcript: ENSMUST00000094933
AA Change: I490F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092538
Gene: ENSMUSG00000028514
AA Change: I490F

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	882	6e-7	SMART
low complexity region	1031	1059	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1365	1378	N/A	INTRINSIC
Pfam:UCH	1685	2036	3.7e-54	PFAM
Pfam:UCH_1	1686	1993	1.8e-27	PFAM
low complexity region	2066	2081	N/A	INTRINSIC
low complexity region	2256	2267	N/A	INTRINSIC
low complexity region	2576	2592	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000106798

SMART Domains

Protein: ENSMUSP00000102410
Gene: ENSMUSG00000028514

Domain	Start	End	E-Value	Type
SCOP:d1ifya_	3	47	2e-6	SMART
Blast:UBA	5	43	2e-17	BLAST
low complexity region	57	96	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165709
AA Change: I491F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000133095
Gene: ENSMUSG00000028514
AA Change: I491F

Domain	Start	End	E-Value	Type
Blast:UBA	5	43	2e-16	BLAST
low complexity region	57	96	N/A	INTRINSIC
SCOP:d1gw5a_	348	883	8e-7	SMART
low complexity region	1032	1060	N/A	INTRINSIC
low complexity region	1125	1151	N/A	INTRINSIC
low complexity region	1366	1379	N/A	INTRINSIC
Pfam:UCH	1686	2037	2e-49	PFAM
Pfam:UCH_1	1687	1994	4e-24	PFAM
low complexity region	2067	2082	N/A	INTRINSIC
low complexity region	2257	2268	N/A	INTRINSIC
low complexity region	2577	2593	N/A	INTRINSIC

Meta Mutation Damage Score

0.2002

Coding Region Coverage

1x: 99.3%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

95% (80/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Modification of cellular proteins by ubiquitin is an essential regulatory mechanism controlled by the coordinated action of multiple ubiquitin-conjugating and deubiquitinating enzymes. USP24 belongs to a large family of cysteine proteases that function as deubiquitinating enzymes (Quesada et al., 2004 [PubMed 14715245]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310033P09Rik	A	G	11: 59,208,702		probably benign	Het
4932431P20Rik	A	G	7: 29,534,890		noncoding transcript	Het
A730015C16Rik	G	A	4: 108,848,008	V40M	probably damaging	Het
Abcg2	A	G	6: 58,678,337	D419G	probably benign	Het
Adamts17	A	C	7: 67,075,343	E777A	probably damaging	Het
Ak1	A	G	2: 32,633,466	K166R	probably benign	Het
Ankrd12	T	C	17: 65,986,305	K711R	probably damaging	Het
Ate1	A	T	7: 130,418,571		probably null	Het
Atp5a1	A	G	18: 77,781,925	H519R	probably benign	Het
Best1	G	T	19: 9,990,489	Y284*	probably null	Het
C2cd6	A	G	1: 59,076,728		probably benign	Het
Casz1	G	T	4: 148,946,171	V1216L	probably benign	Het
Cdc42bpg	A	G	19: 6,313,782	D493G	probably damaging	Het
Ces2f	A	G	8: 104,952,502	D317G	possibly damaging	Het
Chst15	A	T	7: 132,270,273	M93K	possibly damaging	Het
Cntnap5a	T	C	1: 115,901,020	L58P	probably damaging	Het
Crip3	T	C	17: 46,430,776		probably benign	Het
Csmd2	G	A	4: 128,487,001	E2117K	probably benign	Het
Cstf3	A	G	2: 104,648,219	D212G	possibly damaging	Het
Cttnbp2	T	C	6: 18,434,221	K546R	probably damaging	Het
Cubn	A	G	2: 13,476,120	I308T	probably benign	Het
Cxcl9	T	A	5: 92,325,113	D75V	probably damaging	Het
Dcdc5	C	T	2: 106,358,632		noncoding transcript	Het
Defa30	C	A	8: 21,134,736	T25K	possibly damaging	Het
Dock7	A	T	4: 99,079,435	H239Q	possibly damaging	Het
Dpp4	A	G	2: 62,347,901	V629A	possibly damaging	Het
Fam83a	T	C	15: 58,009,945	M390T	probably benign	Het
Fem1c	A	G	18: 46,524,485	L54P	probably damaging	Het
Fntb	T	A	12: 76,910,233	M282K	probably benign	Het
Gm11099	G	A	2: 58,859,470		probably benign	Het
Gm1527	T	C	3: 28,926,556	S602P	probably benign	Het
Gm20388	A	G	8: 122,269,584		probably benign	Het
Gm5478	T	A	15: 101,644,645	I331F	probably damaging	Het
Gm7853	C	A	14: 36,089,583		noncoding transcript	Het
Gsta2	A	T	9: 78,341,865	C18S	probably benign	Het
H1foo	T	C	6: 115,947,740	V69A	possibly damaging	Het
Hecw1	T	C	13: 14,306,086	E465G	probably damaging	Het
Herc1	A	G	9: 66,508,266	D4841G	probably damaging	Het
Hus1b	A	G	13: 30,947,001	V225A	probably benign	Het
Keg1	A	T	19: 12,716,023	M137L	probably benign	Het
Kmt2a	C	T	9: 44,824,635		probably benign	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mga	T	A	2: 119,941,675	V1672E	probably damaging	Het
Mios	T	C	6: 8,234,237	S803P	probably benign	Het
Mkl1	T	C	15: 81,018,208		probably benign	Het
Msh4	A	T	3: 153,863,384	Y851N	probably damaging	Het
Mybl1	A	C	1: 9,672,661		probably null	Het
Myo5c	A	G	9: 75,275,939	Y865C	probably damaging	Het
Naip1	T	C	13: 100,426,870	S596G	probably benign	Het
Nek5	G	T	8: 22,096,731	Q355K	possibly damaging	Het
Nphp3	G	T	9: 104,025,927	R701L	possibly damaging	Het
Olfr1006	T	A	2: 85,674,918	T78S	possibly damaging	Het
Olfr1023	T	A	2: 85,887,248	Y149*	probably null	Het
Olfr1052	T	C	2: 86,298,479	I221T	probably damaging	Het
Olfr1094	T	C	2: 86,829,198	S149P	probably benign	Het
Olfr666	A	T	7: 104,893,237	Y130*	probably null	Het
Palm	A	G	10: 79,815,187	N149D	possibly damaging	Het
Pot1b	T	C	17: 55,653,451	I626M	possibly damaging	Het
Ptprt	T	A	2: 161,927,484	D487V	probably damaging	Het
Qpct	A	G	17: 79,070,772	I124V	probably benign	Het
Rbm12b1	T	A	4: 12,145,817	D596E	possibly damaging	Het
Rnf157	A	G	11: 116,354,759	C277R	probably damaging	Het
Rnf169	A	G	7: 99,925,328	S687P	possibly damaging	Het
Sfxn1	T	A	13: 54,092,450		probably null	Het
Slc6a21	T	C	7: 45,272,628	V649A	probably benign	Het
Slit3	A	T	11: 35,686,299	T1120S	probably damaging	Het
Spem2	A	T	11: 69,818,070	M58K	probably benign	Het
Sprr2k	T	A	3: 92,433,396		probably benign	Het
Sspo	T	C	6: 48,463,400		probably null	Het
Sv2b	A	T	7: 75,120,043	F584I	possibly damaging	Het
Tkfc	A	T	19: 10,595,326	M317K	probably null	Het
Tnni3k	C	T	3: 155,030,305	G134S	probably benign	Het
Ttn	C	T	2: 76,739,780	R26923H	probably damaging	Het
Tuba3b	T	C	6: 145,618,453	V75A	possibly damaging	Het
Unc79	T	C	12: 103,183,525	L2626P	probably damaging	Het
V1ra8	A	T	6: 90,203,150	I112F	probably damaging	Het
Vmn1r29	T	G	6: 58,307,678	F128V	probably benign	Het
Zfp157	T	A	5: 138,455,095		probably null	Het

Other mutations in Usp24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00329:Usp24	APN	4	106359091	missense	probably benign
IGL00340:Usp24	APN	4	106401139	missense	probably damaging	0.99
IGL00480:Usp24	APN	4	106368106	missense	probably damaging	0.99
IGL00548:Usp24	APN	4	106341298	missense	probably damaging	0.96
IGL00655:Usp24	APN	4	106390318	missense	probably damaging	0.99
IGL00674:Usp24	APN	4	106372679	splice site	probably benign
IGL00718:Usp24	APN	4	106409704	missense	probably benign	0.10
IGL00803:Usp24	APN	4	106385526	splice site	probably benign
IGL01161:Usp24	APN	4	106436844	missense	probably benign	0.02
IGL01344:Usp24	APN	4	106379385	missense	possibly damaging	0.73
IGL01374:Usp24	APN	4	106380099	missense	possibly damaging	0.86
IGL01485:Usp24	APN	4	106362232	missense	probably benign	0.01
IGL01736:Usp24	APN	4	106423461	missense	probably benign	0.00
IGL01737:Usp24	APN	4	106387734	missense	probably benign	0.03
IGL01862:Usp24	APN	4	106408898	splice site	probably benign
IGL01981:Usp24	APN	4	106375768	splice site	probably benign
IGL02090:Usp24	APN	4	106411426	missense	possibly damaging	0.55
IGL02275:Usp24	APN	4	106387493	missense	probably damaging	1.00
IGL02352:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02359:Usp24	APN	4	106403925	missense	probably damaging	1.00
IGL02391:Usp24	APN	4	106407129	missense	possibly damaging	0.60
IGL02418:Usp24	APN	4	106436360	missense	probably benign	0.07
IGL02537:Usp24	APN	4	106392367	missense	probably damaging	1.00
IGL02638:Usp24	APN	4	106438770	splice site	probably benign
IGL02638:Usp24	APN	4	106438772	splice site	probably benign
IGL02830:Usp24	APN	4	106347387	missense	possibly damaging	0.79
IGL03125:Usp24	APN	4	106392402	missense	probably benign	0.09
IGL03280:Usp24	APN	4	106380430	missense	probably damaging	1.00
IGL03350:Usp24	APN	4	106371079	nonsense	probably null
BB010:Usp24	UTSW	4	106428489	missense	probably benign
BB020:Usp24	UTSW	4	106428489	missense	probably benign
IGL03098:Usp24	UTSW	4	106371033	missense	probably benign	0.11
R0035:Usp24	UTSW	4	106368027	missense	probably benign	0.18
R0044:Usp24	UTSW	4	106412084	splice site	probably benign
R0086:Usp24	UTSW	4	106392360	missense	probably damaging	0.98
R0125:Usp24	UTSW	4	106397299	missense	possibly damaging	0.76
R0197:Usp24	UTSW	4	106407133	missense	probably damaging	1.00
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0240:Usp24	UTSW	4	106414404	nonsense	probably null
R0491:Usp24	UTSW	4	106402105	missense	probably benign	0.41
R0687:Usp24	UTSW	4	106420504	missense	probably damaging	1.00
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0973:Usp24	UTSW	4	106413678	splice site	probably null
R0973:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106371079	nonsense	probably null
R0974:Usp24	UTSW	4	106413678	splice site	probably null
R1163:Usp24	UTSW	4	106420960	missense	probably benign
R1293:Usp24	UTSW	4	106423553	missense	probably benign	0.19
R1333:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R1699:Usp24	UTSW	4	106438827	missense	probably damaging	0.99
R1728:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1729:Usp24	UTSW	4	106360421	missense	possibly damaging	0.85
R1753:Usp24	UTSW	4	106377559	missense	probably benign	0.04
R1917:Usp24	UTSW	4	106410286	missense	probably damaging	1.00
R2045:Usp24	UTSW	4	106400980	missense	possibly damaging	0.54
R2424:Usp24	UTSW	4	106399113	critical splice donor site	probably null
R2436:Usp24	UTSW	4	106409645	nonsense	probably null
R2513:Usp24	UTSW	4	106379405	splice site	probably null
R3824:Usp24	UTSW	4	106379066	missense	probably benign
R3831:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3833:Usp24	UTSW	4	106362012	critical splice donor site	probably null
R3982:Usp24	UTSW	4	106387883	missense	probably benign	0.38
R4022:Usp24	UTSW	4	106379224	splice site	probably benign
R4067:Usp24	UTSW	4	106359089	missense	possibly damaging	0.68
R4175:Usp24	UTSW	4	106316773	missense	probably benign	0.00
R4766:Usp24	UTSW	4	106416048	missense	probably damaging	1.00
R4771:Usp24	UTSW	4	106362180	splice site	probably null
R4798:Usp24	UTSW	4	106360162	missense	possibly damaging	0.82
R4809:Usp24	UTSW	4	106413676	critical splice donor site	probably null
R4822:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R4906:Usp24	UTSW	4	106388637	missense	probably benign	0.20
R4934:Usp24	UTSW	4	106426546	missense	probably benign	0.29
R5074:Usp24	UTSW	4	106420447	missense	probably benign	0.12
R5151:Usp24	UTSW	4	106399112	critical splice donor site	probably null
R5220:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R5279:Usp24	UTSW	4	106385424	missense	possibly damaging	0.94
R5280:Usp24	UTSW	4	106341214	missense	probably benign	0.18
R5285:Usp24	UTSW	4	106407033	missense	probably benign	0.00
R5292:Usp24	UTSW	4	106418263	missense	probably benign	0.06
R5294:Usp24	UTSW	4	106362357	missense	possibly damaging	0.53
R5394:Usp24	UTSW	4	106408013	missense	probably damaging	1.00
R5517:Usp24	UTSW	4	106375674	missense	probably benign	0.02
R5522:Usp24	UTSW	4	106372721	missense	probably damaging	1.00
R5546:Usp24	UTSW	4	106416047	missense	probably damaging	0.98
R5756:Usp24	UTSW	4	106362483	missense	probably damaging	1.00
R5910:Usp24	UTSW	4	106380468	missense	probably damaging	0.99
R5972:Usp24	UTSW	4	106368067	missense	probably damaging	0.98
R6285:Usp24	UTSW	4	106374100	splice site	probably null
R6370:Usp24	UTSW	4	106380521	missense	probably null	0.20
R6630:Usp24	UTSW	4	106387835	missense	possibly damaging	0.69
R6754:Usp24	UTSW	4	106360420	missense	probably damaging	1.00
R7027:Usp24	UTSW	4	106362244	missense	probably benign	0.21
R7088:Usp24	UTSW	4	106387546	missense	probably damaging	1.00
R7129:Usp24	UTSW	4	106362215	missense	probably damaging	1.00
R7131:Usp24	UTSW	4	106382303	missense	possibly damaging	0.69
R7156:Usp24	UTSW	4	106387919	critical splice donor site	probably null
R7174:Usp24	UTSW	4	106362681	splice site	probably null
R7236:Usp24	UTSW	4	106406305	splice site	probably null
R7403:Usp24	UTSW	4	106407035	missense	possibly damaging	0.79
R7424:Usp24	UTSW	4	106379107	missense	probably benign	0.00
R7475:Usp24	UTSW	4	106342353	missense	possibly damaging	0.55
R7505:Usp24	UTSW	4	106379079	missense	probably damaging	1.00
R7782:Usp24	UTSW	4	106316574	missense	probably damaging	1.00
R7900:Usp24	UTSW	4	106409400	missense	probably damaging	1.00
R7933:Usp24	UTSW	4	106428489	missense	probably benign
R7940:Usp24	UTSW	4	106430544	missense	probably damaging	0.98
R8271:Usp24	UTSW	4	106428514	missense	probably damaging	0.98
R8348:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8448:Usp24	UTSW	4	106368736	missense	possibly damaging	0.82
R8483:Usp24	UTSW	4	106373756	missense	probably damaging	1.00
R8546:Usp24	UTSW	4	106402129	missense	probably benign	0.01
R8798:Usp24	UTSW	4	106379239	missense	probably benign	0.00
R8822:Usp24	UTSW	4	106412213	missense	probably benign	0.17
R8992:Usp24	UTSW	4	106377565	missense	probably benign	0.36
R9002:Usp24	UTSW	4	106418215	missense	possibly damaging	0.72
R9037:Usp24	UTSW	4	106379054	missense	probably damaging	0.99
R9068:Usp24	UTSW	4	106375678	missense	probably benign	0.09
R9096:Usp24	UTSW	4	106397311	missense	probably benign	0.00
R9180:Usp24	UTSW	4	106359050	missense	possibly damaging	0.71
R9199:Usp24	UTSW	4	106387484	missense	probably damaging	1.00
R9201:Usp24	UTSW	4	106420530	missense	probably benign	0.36
R9251:Usp24	UTSW	4	106360518	missense	probably benign	0.19
R9423:Usp24	UTSW	4	106431670	missense	probably damaging	1.00
R9459:Usp24	UTSW	4	106342358	missense	probably damaging	1.00
R9472:Usp24	UTSW	4	106403931	missense	probably benign	0.00
R9483:Usp24	UTSW	4	106362182	missense	probably damaging	0.99
R9534:Usp24	UTSW	4	106407115	missense	probably damaging	0.97
R9653:Usp24	UTSW	4	106347367	missense	probably benign	0.03
R9712:Usp24	UTSW	4	106347367	missense	probably benign	0.03
X0024:Usp24	UTSW	4	106360446	missense	probably benign	0.09
X0028:Usp24	UTSW	4	106368055	missense	probably benign	0.01
X0066:Usp24	UTSW	4	106355731	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- TTGTGTGACCCTGAACCTCCAGTG -3'
(R):5'- ATTCGTCCGATCAGACTCAGCAAC -3'

Sequencing Primer
(F):5'- CCTGAACCTCCAGTGTTGTC -3'
(R):5'- GATCAGACTCAGCAACTTCTGTC -3'

Posted On

2014-03-28