Incidental Mutation 'R1476:Qpct'
ID164101
Institutional Source Beutler Lab
Gene Symbol Qpct
Ensembl Gene ENSMUSG00000024084
Gene Nameglutaminyl-peptide cyclotransferase (glutaminyl cyclase)
Synonyms5730422A13Rik
MMRRC Submission 039529-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.280) question?
Stock #R1476 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location79051906-79090243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 79070772 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 124 (I124V)
Ref Sequence ENSEMBL: ENSMUSP00000038732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040789]
Predicted Effect probably benign
Transcript: ENSMUST00000040789
AA Change: I124V

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000038732
Gene: ENSMUSG00000024084
AA Change: I124V

DomainStartEndE-ValueType
low complexity region 8 26 N/A INTRINSIC
Pfam:Peptidase_M28 123 356 2.1e-51 PFAM
Meta Mutation Damage Score 0.0959 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 95% (80/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes human pituitary glutaminyl cyclase, which is responsible for the presence of pyroglutamyl residues in many neuroendocrine peptides. The amino acid sequence of this enzyme is 86% identical to that of bovine glutaminyl cyclase. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice exhibit normal motor coordination and spatial working memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,702 probably benign Het
4932431P20Rik A G 7: 29,534,890 noncoding transcript Het
A730015C16Rik G A 4: 108,848,008 V40M probably damaging Het
Abcg2 A G 6: 58,678,337 D419G probably benign Het
Adamts17 A C 7: 67,075,343 E777A probably damaging Het
Ak1 A G 2: 32,633,466 K166R probably benign Het
Ankrd12 T C 17: 65,986,305 K711R probably damaging Het
Ate1 A T 7: 130,418,571 probably null Het
Atp5a1 A G 18: 77,781,925 H519R probably benign Het
Best1 G T 19: 9,990,489 Y284* probably null Het
C2cd6 A G 1: 59,076,728 probably benign Het
Casz1 G T 4: 148,946,171 V1216L probably benign Het
Cdc42bpg A G 19: 6,313,782 D493G probably damaging Het
Ces2f A G 8: 104,952,502 D317G possibly damaging Het
Chst15 A T 7: 132,270,273 M93K possibly damaging Het
Cntnap5a T C 1: 115,901,020 L58P probably damaging Het
Crip3 T C 17: 46,430,776 probably benign Het
Csmd2 G A 4: 128,487,001 E2117K probably benign Het
Cstf3 A G 2: 104,648,219 D212G possibly damaging Het
Cttnbp2 T C 6: 18,434,221 K546R probably damaging Het
Cubn A G 2: 13,476,120 I308T probably benign Het
Cxcl9 T A 5: 92,325,113 D75V probably damaging Het
Dcdc5 C T 2: 106,358,632 noncoding transcript Het
Defa30 C A 8: 21,134,736 T25K possibly damaging Het
Dock7 A T 4: 99,079,435 H239Q possibly damaging Het
Dpp4 A G 2: 62,347,901 V629A possibly damaging Het
Fam83a T C 15: 58,009,945 M390T probably benign Het
Fem1c A G 18: 46,524,485 L54P probably damaging Het
Fntb T A 12: 76,910,233 M282K probably benign Het
Gm11099 G A 2: 58,859,470 probably benign Het
Gm1527 T C 3: 28,926,556 S602P probably benign Het
Gm20388 A G 8: 122,269,584 probably benign Het
Gm5478 T A 15: 101,644,645 I331F probably damaging Het
Gm7853 C A 14: 36,089,583 noncoding transcript Het
Gsta2 A T 9: 78,341,865 C18S probably benign Het
H1foo T C 6: 115,947,740 V69A possibly damaging Het
Hecw1 T C 13: 14,306,086 E465G probably damaging Het
Herc1 A G 9: 66,508,266 D4841G probably damaging Het
Hus1b A G 13: 30,947,001 V225A probably benign Het
Keg1 A T 19: 12,716,023 M137L probably benign Het
Kmt2a C T 9: 44,824,635 probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mga T A 2: 119,941,675 V1672E probably damaging Het
Mios T C 6: 8,234,237 S803P probably benign Het
Mkl1 T C 15: 81,018,208 probably benign Het
Msh4 A T 3: 153,863,384 Y851N probably damaging Het
Mybl1 A C 1: 9,672,661 probably null Het
Myo5c A G 9: 75,275,939 Y865C probably damaging Het
Naip1 T C 13: 100,426,870 S596G probably benign Het
Nek5 G T 8: 22,096,731 Q355K possibly damaging Het
Nphp3 G T 9: 104,025,927 R701L possibly damaging Het
Olfr1006 T A 2: 85,674,918 T78S possibly damaging Het
Olfr1023 T A 2: 85,887,248 Y149* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1094 T C 2: 86,829,198 S149P probably benign Het
Olfr666 A T 7: 104,893,237 Y130* probably null Het
Palm A G 10: 79,815,187 N149D possibly damaging Het
Pot1b T C 17: 55,653,451 I626M possibly damaging Het
Ptprt T A 2: 161,927,484 D487V probably damaging Het
Rbm12b1 T A 4: 12,145,817 D596E possibly damaging Het
Rnf157 A G 11: 116,354,759 C277R probably damaging Het
Rnf169 A G 7: 99,925,328 S687P possibly damaging Het
Sfxn1 T A 13: 54,092,450 probably null Het
Slc6a21 T C 7: 45,272,628 V649A probably benign Het
Slit3 A T 11: 35,686,299 T1120S probably damaging Het
Spem2 A T 11: 69,818,070 M58K probably benign Het
Sprr2k T A 3: 92,433,396 probably benign Het
Sspo T C 6: 48,463,400 probably null Het
Sv2b A T 7: 75,120,043 F584I possibly damaging Het
Tkfc A T 19: 10,595,326 M317K probably null Het
Tnni3k C T 3: 155,030,305 G134S probably benign Het
Ttn C T 2: 76,739,780 R26923H probably damaging Het
Tuba3b T C 6: 145,618,453 V75A possibly damaging Het
Unc79 T C 12: 103,183,525 L2626P probably damaging Het
Usp24 A T 4: 106,361,933 I491F probably damaging Het
V1ra8 A T 6: 90,203,150 I112F probably damaging Het
Vmn1r29 T G 6: 58,307,678 F128V probably benign Het
Zfp157 T A 5: 138,455,095 probably null Het
Other mutations in Qpct
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00650:Qpct APN 17 79070889 missense probably damaging 1.00
IGL01490:Qpct APN 17 79089740 missense probably benign 0.10
IGL02147:Qpct APN 17 79070716 missense probably damaging 0.99
IGL03006:Qpct APN 17 79070722 missense probably benign 0.22
IGL03007:Qpct APN 17 79070865 missense probably damaging 1.00
IGL03168:Qpct APN 17 79052324 missense unknown
PIT4354001:Qpct UTSW 17 79081759 missense probably benign 0.00
R0268:Qpct UTSW 17 79077652 missense probably benign 0.04
R1563:Qpct UTSW 17 79064063 missense probably benign
R2157:Qpct UTSW 17 79070686 missense probably benign 0.19
R2846:Qpct UTSW 17 79070742 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCTCTCCTTTCAACGAGAAGCTGC -3'
(R):5'- TAAGGCACGGGCAAGTTCCAACATC -3'

Sequencing Primer
(F):5'- tggaatgaggaggaaggagg -3'
(R):5'- GTTCCAACATCATTGCACATGG -3'
Posted On2014-03-28