Incidental Mutation 'R1477:Arfgef1'
ID164108
Institutional Source Beutler Lab
Gene Symbol Arfgef1
Ensembl Gene ENSMUSG00000067851
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
SynonymsP200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik
MMRRC Submission 039530-MU
Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location10137571-10232670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 10189284 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 619 (C619S)
Ref Sequence ENSEMBL: ENSMUSP00000085986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088615] [ENSMUST00000131556]
Predicted Effect probably damaging
Transcript: ENSMUST00000088615
AA Change: C619S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: C619S

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131556
AA Change: C619S

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000118805
Gene: ENSMUSG00000067851
AA Change: C619S

DomainStartEndE-ValueType
coiled coil region 207 234 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 413 576 3.1e-59 PFAM
Blast:Sec7 588 637 2e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 3e-13 BLAST
Blast:Sec7 947 986 2e-18 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Arfgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arfgef1 APN 1 10199787 missense probably benign
IGL00919:Arfgef1 APN 1 10173237 missense probably damaging 1.00
IGL01022:Arfgef1 APN 1 10174076 missense probably damaging 1.00
IGL01155:Arfgef1 APN 1 10198982 splice site probably benign
IGL01288:Arfgef1 APN 1 10213211 missense possibly damaging 0.67
IGL01397:Arfgef1 APN 1 10159571 missense probably benign 0.40
IGL01433:Arfgef1 APN 1 10153432 missense probably damaging 1.00
IGL01653:Arfgef1 APN 1 10159908 nonsense probably null
IGL01669:Arfgef1 APN 1 10159615 missense probably damaging 1.00
IGL01795:Arfgef1 APN 1 10147528 missense probably benign 0.01
IGL01860:Arfgef1 APN 1 10154396 missense probably damaging 1.00
IGL02137:Arfgef1 APN 1 10213113 missense probably damaging 1.00
IGL02365:Arfgef1 APN 1 10199883 missense probably benign 0.00
IGL02519:Arfgef1 APN 1 10209668 missense probably benign 0.13
IGL02542:Arfgef1 APN 1 10172842 missense probably benign 0.24
IGL02604:Arfgef1 APN 1 10181050 splice site probably benign
IGL02743:Arfgef1 APN 1 10199829 missense probably benign 0.00
IGL03225:Arfgef1 APN 1 10154318 missense probably damaging 1.00
Collected UTSW 1 10180938 missense probably damaging 1.00
uncle_joe UTSW 1 10160835 missense probably damaging 1.00
I2288:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
I2289:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
R0383:Arfgef1 UTSW 1 10198842 critical splice donor site probably null
R0491:Arfgef1 UTSW 1 10179987 splice site probably benign
R0636:Arfgef1 UTSW 1 10199851 missense probably benign
R1006:Arfgef1 UTSW 1 10140481 missense probably benign 0.00
R1212:Arfgef1 UTSW 1 10216559 missense probably benign 0.05
R1233:Arfgef1 UTSW 1 10184090 missense probably damaging 1.00
R1346:Arfgef1 UTSW 1 10159733 missense probably benign 0.41
R1416:Arfgef1 UTSW 1 10172939 missense probably damaging 1.00
R1581:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1587:Arfgef1 UTSW 1 10159959 missense probably damaging 0.99
R1602:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1745:Arfgef1 UTSW 1 10173255 missense probably damaging 1.00
R1831:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1832:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1833:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1918:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1919:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2059:Arfgef1 UTSW 1 10188752 splice site probably null
R2146:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2148:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2149:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2150:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2373:Arfgef1 UTSW 1 10174142 missense probably damaging 1.00
R2516:Arfgef1 UTSW 1 10153654 missense possibly damaging 0.89
R3863:Arfgef1 UTSW 1 10142586 frame shift probably null
R3916:Arfgef1 UTSW 1 10189443 missense probably benign 0.01
R3948:Arfgef1 UTSW 1 10142586 frame shift probably null
R3949:Arfgef1 UTSW 1 10142586 frame shift probably null
R3977:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3978:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3979:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R4086:Arfgef1 UTSW 1 10163759 missense probably benign 0.06
R4175:Arfgef1 UTSW 1 10159636 missense probably damaging 1.00
R4257:Arfgef1 UTSW 1 10159546 intron probably benign
R4572:Arfgef1 UTSW 1 10213141 missense probably damaging 1.00
R4652:Arfgef1 UTSW 1 10173262 missense probably damaging 0.98
R4678:Arfgef1 UTSW 1 10142666 missense probably benign 0.03
R4737:Arfgef1 UTSW 1 10189611 missense possibly damaging 0.85
R4779:Arfgef1 UTSW 1 10153733 missense probably damaging 1.00
R4818:Arfgef1 UTSW 1 10216547 missense probably benign
R4898:Arfgef1 UTSW 1 10159573 missense possibly damaging 0.75
R4979:Arfgef1 UTSW 1 10213109 missense probably damaging 1.00
R5039:Arfgef1 UTSW 1 10199736 missense probably benign 0.37
R5194:Arfgef1 UTSW 1 10204907 missense probably benign 0.09
R5428:Arfgef1 UTSW 1 10160835 missense probably damaging 1.00
R5533:Arfgef1 UTSW 1 10199727 critical splice donor site probably null
R5547:Arfgef1 UTSW 1 10160976 missense probably damaging 1.00
R5562:Arfgef1 UTSW 1 10144746 missense probably damaging 1.00
R5635:Arfgef1 UTSW 1 10188860 missense possibly damaging 0.81
R5697:Arfgef1 UTSW 1 10160838 missense probably benign 0.03
R5704:Arfgef1 UTSW 1 10159583 missense probably damaging 0.98
R5722:Arfgef1 UTSW 1 10138884 missense probably benign 0.04
R5793:Arfgef1 UTSW 1 10209528 missense probably benign 0.01
R5835:Arfgef1 UTSW 1 10160739 missense probably damaging 1.00
R5870:Arfgef1 UTSW 1 10180938 missense probably damaging 1.00
R5990:Arfgef1 UTSW 1 10172921 missense probably damaging 0.99
R6290:Arfgef1 UTSW 1 10188811 missense possibly damaging 0.91
R6460:Arfgef1 UTSW 1 10213060 missense probably damaging 1.00
R6613:Arfgef1 UTSW 1 10194396 missense possibly damaging 0.95
R6802:Arfgef1 UTSW 1 10189452 missense probably benign 0.35
R6967:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6967:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6968:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6968:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6969:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6969:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6970:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6970:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R7092:Arfgef1 UTSW 1 10153676 missense probably damaging 1.00
R7251:Arfgef1 UTSW 1 10198975 missense possibly damaging 0.81
R7334:Arfgef1 UTSW 1 10184460 missense probably damaging 1.00
R7399:Arfgef1 UTSW 1 10180897 missense probably benign 0.00
R7631:Arfgef1 UTSW 1 10232469 missense probably benign 0.00
R7699:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7700:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7772:Arfgef1 UTSW 1 10157010 missense possibly damaging 0.96
R7968:Arfgef1 UTSW 1 10172920 missense probably damaging 1.00
R8195:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
R8292:Arfgef1 UTSW 1 10156969 missense probably benign 0.06
R8301:Arfgef1 UTSW 1 10179833 missense probably damaging 1.00
R8341:Arfgef1 UTSW 1 10154328 missense probably benign 0.37
R8410:Arfgef1 UTSW 1 10159642 missense possibly damaging 0.94
R8411:Arfgef1 UTSW 1 10216534 missense probably benign 0.01
R8793:Arfgef1 UTSW 1 10142607 missense possibly damaging 0.95
V1662:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCAGACATCTGTGTACTGTAGC -3'
(R):5'- ACCTGTCGAAAATTGCCCAAGGAAG -3'

Sequencing Primer
(F):5'- AGCTGCCAATTCCTGATGATG -3'
(R):5'- GCAGCCAAGAACTTGGTATG -3'
Posted On2014-03-28