Incidental Mutation 'R1477:Olfr212'
ID164121
Institutional Source Beutler Lab
Gene Symbol Olfr212
Ensembl Gene ENSMUSG00000053251
Gene Nameolfactory receptor 212
Synonyms4931403F16Rik, GA_x54KRFPKN04-58149882-58150865, MOR119-4
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location116506516-116517965 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116516665 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 296 (Y296F)
Ref Sequence ENSEMBL: ENSMUSP00000151524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075756] [ENSMUST00000218028] [ENSMUST00000220134]
Predicted Effect probably damaging
Transcript: ENSMUST00000075756
AA Change: Y296F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075164
Gene: ENSMUSG00000053251
AA Change: Y296F

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 9.3e-44 PFAM
Pfam:7tm_1 47 296 2e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000218028
AA Change: Y296F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000220134
AA Change: Y296F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Olfr212
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1912:Olfr212 UTSW 6 116515989 missense probably benign 0.00
R4035:Olfr212 UTSW 6 116516629 missense possibly damaging 0.94
R4654:Olfr212 UTSW 6 116516448 missense probably damaging 1.00
R5284:Olfr212 UTSW 6 116516552 nonsense probably null
R5772:Olfr212 UTSW 6 116515951 missense possibly damaging 0.70
R6882:Olfr212 UTSW 6 116516434 missense probably benign 0.00
R6944:Olfr212 UTSW 6 116515830 missense possibly damaging 0.95
R7078:Olfr212 UTSW 6 116516671 missense probably damaging 1.00
R7099:Olfr212 UTSW 6 116516760 makesense probably null
R7205:Olfr212 UTSW 6 116515975 missense probably damaging 1.00
R7556:Olfr212 UTSW 6 116516736 nonsense probably null
R8155:Olfr212 UTSW 6 116515852 missense probably benign 0.16
R8530:Olfr212 UTSW 6 116516569 missense probably damaging 1.00
RF016:Olfr212 UTSW 6 116516043 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGGTAGCCATCTTTGCATACAGCAAC -3'
(R):5'- GTTTGATTCACCATTCACAACTCAAGCC -3'

Sequencing Primer
(F):5'- TGCATACAGCAACATAGTGGTC -3'
(R):5'- GGTCTTCATTTACACCAAAGCAG -3'
Posted On2014-03-28