Incidental Mutation 'R1477:Olfr61'
ID164130
Institutional Source Beutler Lab
Gene Symbol Olfr61
Ensembl Gene ENSMUSG00000096069
Gene Nameolfactory receptor 61
SynonymsMOR253-1, IH7, GA_x6K02T2PBJ9-42783826-42784758
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location140628970-140638798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140638442 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 247 (I247N)
Ref Sequence ENSEMBL: ENSMUSP00000147924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084455] [ENSMUST00000210241] [ENSMUST00000210373] [ENSMUST00000211685]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084455
AA Change: I247N

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081493
Gene: ENSMUSG00000096069
AA Change: I247N

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 3.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 175 1.3e-8 PFAM
Pfam:7tm_1 42 291 3.6e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210241
AA Change: I247N

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000210373
Predicted Effect possibly damaging
Transcript: ENSMUST00000211685
AA Change: I247N

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Olfr61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00958:Olfr61 APN 7 140638256 missense probably damaging 1.00
IGL01837:Olfr61 APN 7 140638211 missense probably damaging 1.00
IGL02349:Olfr61 APN 7 140638471 missense probably benign 0.00
IGL02713:Olfr61 APN 7 140637916 missense probably damaging 0.98
IGL02982:Olfr61 APN 7 140637952 missense probably benign 0.06
IGL03205:Olfr61 APN 7 140638160 missense possibly damaging 0.90
R1564:Olfr61 UTSW 7 140638054 missense probably benign 0.21
R1900:Olfr61 UTSW 7 140638592 missense probably damaging 0.99
R2149:Olfr61 UTSW 7 140638052 missense probably damaging 0.99
R2504:Olfr61 UTSW 7 140638484 missense probably benign 0.01
R2887:Olfr61 UTSW 7 140638225 missense probably damaging 1.00
R3787:Olfr61 UTSW 7 140637835 missense probably benign 0.01
R4628:Olfr61 UTSW 7 140638384 missense probably benign 0.04
R4775:Olfr61 UTSW 7 140637916 missense probably damaging 0.98
R5805:Olfr61 UTSW 7 140638471 missense probably benign 0.00
R6019:Olfr61 UTSW 7 140638012 missense probably benign 0.03
R6244:Olfr61 UTSW 7 140638433 missense probably damaging 1.00
R7303:Olfr61 UTSW 7 140638354 missense probably damaging 1.00
R7505:Olfr61 UTSW 7 140638052 missense probably damaging 1.00
R7783:Olfr61 UTSW 7 140637724 missense possibly damaging 0.86
R7936:Olfr61 UTSW 7 140637739 missense probably damaging 1.00
Z1088:Olfr61 UTSW 7 140638220 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGTCATCACCCACTTCTTCTGTGAG -3'
(R):5'- TGGAATTGTCCAGTCCTGGCAAC -3'

Sequencing Primer
(F):5'- TGTGAGATTCCCCCACTCC -3'
(R):5'- TAGGGAAACCCCACTCTGTG -3'
Posted On2014-03-28