Mutagenetix > Incidental Mutation

Incidental Mutation 'R1477:Mst1r'

164136

Institutional Source

Beutler Lab

Gene Symbol

Mst1r

Ensembl Gene

ENSMUSG00000032584

Gene Name

macrophage stimulating 1 receptor (c-met-related tyrosine kinase)

Synonyms

Fv-2, Ron, CDw136, Fv2, friend virus susceptibility 2, PTK8, STK

MMRRC Submission

039530-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.250) question?

Stock #

R1477 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107906873-107920383 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 107908324 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 394 (S394P)

Ref Sequence

ENSEMBL: ENSMUSP00000142201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035203] [ENSMUST00000195617]

AlphaFold

Q62190

Predicted Effect

probably benign
Transcript: ENSMUST00000035203
AA Change: S394P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000035203
Gene: ENSMUSG00000032584
AA Change: S394P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	510	9.03e-116	SMART
PSI	528	570	8.72e-4	SMART
IPT	570	684	1.63e-18	SMART
IPT	685	769	4.03e-23	SMART
IPT	771	873	8.41e-12	SMART
IPT	878	972	5.36e0	SMART
TyrKc	1059	1318	8.2e-134	SMART
low complexity region	1349	1360	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158380

Predicted Effect

probably benign
Transcript: ENSMUST00000195617
AA Change: S394P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000142201
Gene: ENSMUSG00000032584
AA Change: S394P

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Sema	57	442	3.5e-63	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.4%
20x: 93.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a precursor protein that is proteolytically cleaved to yield an alpha chain and a beta chain which form a membrane-spanning heterodimer. The encoded protein belongs to a family of cell-surface receptor tyrosine kinases involved in signaling from the cell surface to the intracellular environment. The binding of the encoded protein to its ligand, macrophage-stimulating protein, mediates several biological activities including wound healing, tumor immunity, macrophage activation and hematopoiesis as well as cell growth, motility, survival and adhesion. The protein encoded by this gene also functions in early development and the macrophage-mediated inflammatory response. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2013]
PHENOTYPE: This locus controls susceptibility to splenomegaly or spleen focus formation induced by inoculation with Friend leukemia virus. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530053A07Rik	C	A	7: 28,157,093	Q2102K	probably benign	Het
Acsl5	A	C	19: 55,291,472	D481A	probably benign	Het
Adam2	A	C	14: 66,077,700	L8R	possibly damaging	Het
Arfgef1	A	T	1: 10,189,284	C619S	probably damaging	Het
Atm	A	G	9: 53,464,273	I2082T	probably benign	Het
Cgrrf1	A	G	14: 46,853,438	I210M	probably benign	Het
Clec2e	A	T	6: 129,095,200	V72E	probably benign	Het
Cmtr1	T	C	17: 29,697,157	V587A	possibly damaging	Het
Col1a2	T	C	6: 4,539,673	F1314L	unknown	Het
Ctbp2	T	C	7: 132,998,941	E618G	probably damaging	Het
Dock8	A	T	19: 25,095,550	Y398F	possibly damaging	Het
Ezh1	A	T	11: 101,192,984	D733E	probably damaging	Het
Fbxl6	A	G	15: 76,537,734	S202P	probably benign	Het
Gm996	G	C	2: 25,579,753	H49D	possibly damaging	Het
Grid2ip	G	A	5: 143,375,585	A191T	probably damaging	Het
Helz2	T	C	2: 181,232,804	S1966G	probably benign	Het
Ipmk	A	G	10: 71,381,777	K385E	probably damaging	Het
Itga11	G	A	9: 62,755,211	V489I	probably benign	Het
Klhl6	T	C	16: 19,965,977	K137R	probably benign	Het
Meis1	G	A	11: 18,881,665	Q458*	probably null	Het
Mus81	G	T	19: 5,486,334	H155Q	probably benign	Het
Neb	G	A	2: 52,264,122	L2326F	probably damaging	Het
Nf1	C	T	11: 79,395,859	Q162*	probably null	Het
Nin	T	C	12: 70,044,184	E819G	possibly damaging	Het
Nox4	T	C	7: 87,295,866	V79A	probably benign	Het
Olfr212	A	T	6: 116,516,665	Y296F	probably damaging	Het
Olfr291	T	A	7: 84,857,017	I216N	probably damaging	Het
Olfr61	T	A	7: 140,638,442	I247N	possibly damaging	Het
Olfr744	A	T	14: 50,618,713	I164F	probably damaging	Het
Peg3	T	A	7: 6,716,142	D69V	probably damaging	Het
Pih1d3	G	A	1: 31,223,023	V29M	probably benign	Het
Pnp2	A	G	14: 50,959,535	E26G	probably benign	Het
Pnpt1	T	A	11: 29,137,102	C154S	probably benign	Het
Ppp1r26	C	T	2: 28,452,788	T810I	probably benign	Het
Ppp2r5b	A	G	19: 6,230,227	S349P	probably benign	Het
Prdm4	C	T	10: 85,904,265	V424I	probably benign	Het
Rraga	A	G	4: 86,576,759	I281V	probably benign	Het
Sall1	T	C	8: 89,032,882	E198G	probably damaging	Het
Serpina9	T	C	12: 103,997,103	D382G	possibly damaging	Het
Stt3b	A	G	9: 115,266,192	V257A	probably damaging	Het
Taf2	A	T	15: 55,062,172	Y225N	possibly damaging	Het
Tlr3	A	G	8: 45,398,165	L41P	probably damaging	Het
Trappc12	A	T	12: 28,737,752	V444E	probably benign	Het
Trim34a	T	A	7: 104,248,080	V117D	possibly damaging	Het
Ttbk1	A	C	17: 46,476,799	M259R	probably benign	Het
Ttll12	A	G	15: 83,580,102	V509A	probably damaging	Het
Ush2a	G	A	1: 188,849,076	V3718M	probably benign	Het
Vps35	T	A	8: 85,287,800	E73D	probably damaging	Het
Zfp790	C	T	7: 29,823,100		probably benign	Het

Other mutations in Mst1r

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Mst1r	APN	9	107913250	splice site	probably benign
IGL01327:Mst1r	APN	9	107907844	missense	probably benign	0.03
IGL01572:Mst1r	APN	9	107911592	missense	probably damaging	1.00
IGL01968:Mst1r	APN	9	107916806	splice site	probably null
IGL01983:Mst1r	APN	9	107917276	missense	probably damaging	0.99
IGL02096:Mst1r	APN	9	107917279	missense	probably damaging	0.97
IGL02203:Mst1r	APN	9	107913149	missense	possibly damaging	0.61
IGL02203:Mst1r	APN	9	107907869	missense	probably damaging	1.00
IGL02332:Mst1r	APN	9	107907826	nonsense	probably null
IGL02402:Mst1r	APN	9	107916827	missense	probably damaging	0.99
IGL02404:Mst1r	APN	9	107913067	splice site	probably benign
IGL02942:Mst1r	APN	9	107913153	missense	possibly damaging	0.89
IGL02951:Mst1r	APN	9	107908204	missense	possibly damaging	0.88
IGL02975:Mst1r	APN	9	107913180	missense	probably benign	0.20
IGL03005:Mst1r	APN	9	107914549	nonsense	probably null
IGL03304:Mst1r	APN	9	107907938	missense	probably damaging	1.00
R0386:Mst1r	UTSW	9	107916804	splice site	probably null
R0833:Mst1r	UTSW	9	107913167	missense	probably benign
R0833:Mst1r	UTSW	9	107914776	missense	probably benign	0.00
R1139:Mst1r	UTSW	9	107919969	missense	possibly damaging	0.93
R1371:Mst1r	UTSW	9	107917225	missense	probably damaging	1.00
R1479:Mst1r	UTSW	9	107913345	splice site	probably benign
R1541:Mst1r	UTSW	9	107917363	missense	probably damaging	0.99
R1698:Mst1r	UTSW	9	107919980	missense	probably benign	0.06
R1891:Mst1r	UTSW	9	107913462	missense	probably damaging	1.00
R1971:Mst1r	UTSW	9	107913212	missense	probably benign	0.06
R1974:Mst1r	UTSW	9	107914763	missense	probably damaging	1.00
R1974:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R2144:Mst1r	UTSW	9	107913168	missense	probably benign
R2221:Mst1r	UTSW	9	107908348	missense	probably damaging	1.00
R2356:Mst1r	UTSW	9	107917870	missense	probably damaging	1.00
R3913:Mst1r	UTSW	9	107914746	missense	probably benign
R4768:Mst1r	UTSW	9	107911650	missense	probably damaging	1.00
R4793:Mst1r	UTSW	9	107919925	missense	probably damaging	0.96
R5141:Mst1r	UTSW	9	107912241	missense	probably damaging	0.99
R5191:Mst1r	UTSW	9	107911551	missense	probably damaging	0.98
R5238:Mst1r	UTSW	9	107907574	missense	probably damaging	1.00
R6024:Mst1r	UTSW	9	107908151	missense	probably benign	0.00
R6220:Mst1r	UTSW	9	107907348	missense	probably benign	0.11
R6256:Mst1r	UTSW	9	107917266	missense	probably damaging	1.00
R6361:Mst1r	UTSW	9	107915853	missense	probably benign
R6522:Mst1r	UTSW	9	107913239	missense	probably benign	0.00
R6559:Mst1r	UTSW	9	107908271	missense	possibly damaging	0.91
R6863:Mst1r	UTSW	9	107920026	missense	probably benign
R6868:Mst1r	UTSW	9	107915933	critical splice donor site	probably null
R6873:Mst1r	UTSW	9	107911644	missense	possibly damaging	0.90
R6978:Mst1r	UTSW	9	107912594	missense	probably benign	0.23
R7168:Mst1r	UTSW	9	107908193	missense	probably benign	0.01
R7299:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7301:Mst1r	UTSW	9	107914790	missense	possibly damaging	0.46
R7405:Mst1r	UTSW	9	107915122	missense	possibly damaging	0.87
R7615:Mst1r	UTSW	9	107920012	missense	probably benign	0.05
R7684:Mst1r	UTSW	9	107911563	missense	probably benign	0.01
R7741:Mst1r	UTSW	9	107907120	start gained	probably benign
R7916:Mst1r	UTSW	9	107907578	missense	probably damaging	1.00
R7987:Mst1r	UTSW	9	107912798	splice site	probably null
R8177:Mst1r	UTSW	9	107907585	missense	probably damaging	1.00
R8356:Mst1r	UTSW	9	107917264	missense	probably damaging	1.00
R8494:Mst1r	UTSW	9	107914519	missense	possibly damaging	0.90
R8692:Mst1r	UTSW	9	107914851	missense	possibly damaging	0.82
R8979:Mst1r	UTSW	9	107915279	missense	probably damaging	0.98
R9012:Mst1r	UTSW	9	107914761	missense	probably benign	0.01
X0026:Mst1r	UTSW	9	107913203	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- GACTGTCATTTTGCACCTAAACGCC -3'
(R):5'- TGATTTGTGTGTCTTAGCCCACTGC -3'

Sequencing Primer
(F):5'- CCAAACTGGCTGTGGAACTG -3'
(R):5'- GCCTTTTCCCACCCAGG -3'

Posted On

2014-03-28