Incidental Mutation 'R1477:Prdm4'
ID164139
Institutional Source Beutler Lab
Gene Symbol Prdm4
Ensembl Gene ENSMUSG00000035529
Gene NamePR domain containing 4
Synonyms2810470D21Rik, SC-1, 1700031E19Rik
MMRRC Submission 039530-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1477 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location85891966-85917142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85904265 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 424 (V424I)
Ref Sequence ENSEMBL: ENSMUSP00000151931 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037646] [ENSMUST00000218969] [ENSMUST00000219370] [ENSMUST00000220032]
Predicted Effect probably benign
Transcript: ENSMUST00000037646
SMART Domains Protein: ENSMUSP00000041942
Gene: ENSMUSG00000035529

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 339 353 N/A INTRINSIC
PDB:3DB5|B 386 543 2e-98 PDB
Blast:SET 408 538 5e-82 BLAST
ZnF_C2H2 548 569 7.77e1 SMART
low complexity region 575 588 N/A INTRINSIC
ZnF_C2H2 593 615 3.78e-1 SMART
ZnF_C2H2 621 643 2.27e-4 SMART
ZnF_C2H2 649 671 8.02e-5 SMART
ZnF_C2H2 677 699 3.63e-3 SMART
ZnF_C2H2 705 727 3.11e-2 SMART
ZnF_C2H2 733 753 1.81e1 SMART
low complexity region 759 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218743
Predicted Effect probably benign
Transcript: ENSMUST00000218969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219112
Predicted Effect probably benign
Transcript: ENSMUST00000219370
Predicted Effect probably benign
Transcript: ENSMUST00000220032
AA Change: V424I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the PR/SET family of zinc finger proteins. This protein has been shown to bind DNA in a sequence-specific manner and has been implicated in neural stem cell proliferation and differentiation. Pseudogenes have been identified on chromosomes 14 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for alleles lacking the zinc finger domain or PR/SET domain exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Dock8 A T 19: 25,095,550 Y398F possibly damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Prdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Prdm4 APN 10 85893236 missense probably benign 0.08
IGL02514:Prdm4 APN 10 85907917 missense probably damaging 0.99
IGL02576:Prdm4 APN 10 85900937 missense possibly damaging 0.86
IGL02674:Prdm4 APN 10 85893399 missense probably damaging 0.99
IGL03002:Prdm4 APN 10 85893152 missense probably benign 0.08
IGL03153:Prdm4 APN 10 85907996 missense probably benign
IGL03278:Prdm4 APN 10 85907758 missense probably damaging 0.99
IGL03338:Prdm4 APN 10 85907821 missense possibly damaging 0.90
R0020:Prdm4 UTSW 10 85907623 missense probably benign
R0133:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R0366:Prdm4 UTSW 10 85908004 missense probably damaging 1.00
R0633:Prdm4 UTSW 10 85907903 missense probably damaging 1.00
R1132:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R1460:Prdm4 UTSW 10 85907822 missense probably benign 0.28
R1680:Prdm4 UTSW 10 85899223 missense possibly damaging 0.96
R1772:Prdm4 UTSW 10 85893392 missense probably damaging 0.99
R1983:Prdm4 UTSW 10 85907953 missense probably damaging 1.00
R2136:Prdm4 UTSW 10 85893351 nonsense probably null
R3426:Prdm4 UTSW 10 85910289 missense probably damaging 1.00
R3723:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R4490:Prdm4 UTSW 10 85900899 missense probably damaging 1.00
R4750:Prdm4 UTSW 10 85899221 missense probably damaging 1.00
R5561:Prdm4 UTSW 10 85893123 makesense probably null
R5601:Prdm4 UTSW 10 85893123 makesense probably null
R5602:Prdm4 UTSW 10 85893123 makesense probably null
R5604:Prdm4 UTSW 10 85893123 makesense probably null
R5972:Prdm4 UTSW 10 85907501 missense probably damaging 1.00
R6272:Prdm4 UTSW 10 85907830 missense possibly damaging 0.82
R6300:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R6457:Prdm4 UTSW 10 85908032 missense probably damaging 1.00
R6605:Prdm4 UTSW 10 85904138 missense probably benign 0.00
R6642:Prdm4 UTSW 10 85907818 missense probably benign 0.00
R7663:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGTCTCTTCAGCACTGACCTTCC -3'
(R):5'- AGCTTCTGAATTACTGTGCCAGTCC -3'

Sequencing Primer
(F):5'- CACTGACCTTCCAGACATGG -3'
(R):5'- gagagagagagagagagagagag -3'
Posted On2014-03-28