Incidental Mutation 'R1477:Nin'
ID 164147
Institutional Source Beutler Lab
Gene Symbol Nin
Ensembl Gene ENSMUSG00000021068
Gene Name ninein
Synonyms 3110068G20Rik
MMRRC Submission 039530-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1477 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 70058209-70160491 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 70090958 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 819 (E819G)
Ref Sequence ENSEMBL: ENSMUSP00000152240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021468] [ENSMUST00000085314] [ENSMUST00000095666] [ENSMUST00000169074] [ENSMUST00000220689] [ENSMUST00000223257] [ENSMUST00000222237] [ENSMUST00000222835]
AlphaFold Q61043
Predicted Effect possibly damaging
Transcript: ENSMUST00000021468
AA Change: E819G

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000021468
Gene: ENSMUSG00000021068
AA Change: E819G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000085314
AA Change: E819G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000082422
Gene: ENSMUSG00000021068
AA Change: E819G

DomainStartEndE-ValueType
internal_repeat_1 7 67 4.15e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 4.15e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1971 2045 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000095666
AA Change: E819G

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093327
Gene: ENSMUSG00000021068
AA Change: E819G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169074
AA Change: E819G

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129648
Gene: ENSMUSG00000021068
AA Change: E819G

DomainStartEndE-ValueType
internal_repeat_1 7 67 7.83e-8 PROSPERO
low complexity region 97 108 N/A INTRINSIC
low complexity region 115 132 N/A INTRINSIC
internal_repeat_1 181 242 7.83e-8 PROSPERO
low complexity region 276 289 N/A INTRINSIC
low complexity region 336 353 N/A INTRINSIC
coiled coil region 358 570 N/A INTRINSIC
coiled coil region 625 802 N/A INTRINSIC
coiled coil region 834 926 N/A INTRINSIC
coiled coil region 957 1008 N/A INTRINSIC
low complexity region 1035 1044 N/A INTRINSIC
low complexity region 1047 1057 N/A INTRINSIC
coiled coil region 1069 1094 N/A INTRINSIC
coiled coil region 1178 1325 N/A INTRINSIC
low complexity region 1374 1385 N/A INTRINSIC
coiled coil region 1425 1806 N/A INTRINSIC
coiled coil region 1980 2013 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000220689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221486
Predicted Effect possibly damaging
Transcript: ENSMUST00000223257
AA Change: E819G

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000222237
AA Change: E819G

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000222835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223316
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the proteins important for centrosomal function. This protein is important for positioning and anchoring the microtubules minus-ends in epithelial cells. Localization of this protein to the centrosome requires three leucine zippers in the central coiled-coil domain. Multiple alternatively spliced transcript variants that encode different isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsl5 A C 19: 55,279,904 (GRCm39) D481A probably benign Het
Adam2 A C 14: 66,315,149 (GRCm39) L8R possibly damaging Het
Ajm1 G C 2: 25,469,765 (GRCm39) H49D possibly damaging Het
Arfgef1 A T 1: 10,259,509 (GRCm39) C619S probably damaging Het
Atm A G 9: 53,375,573 (GRCm39) I2082T probably benign Het
Cgrrf1 A G 14: 47,090,895 (GRCm39) I210M probably benign Het
Clec2e A T 6: 129,072,163 (GRCm39) V72E probably benign Het
Cmtr1 T C 17: 29,916,131 (GRCm39) V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 (GRCm39) F1314L unknown Het
Ctbp2 T C 7: 132,600,670 (GRCm39) E618G probably damaging Het
Dnaaf6rt G A 1: 31,262,104 (GRCm39) V29M probably benign Het
Dock8 A T 19: 25,072,914 (GRCm39) Y398F possibly damaging Het
Ezh1 A T 11: 101,083,810 (GRCm39) D733E probably damaging Het
Fbxl6 A G 15: 76,421,934 (GRCm39) S202P probably benign Het
Fcgbpl1 C A 7: 27,856,518 (GRCm39) Q2102K probably benign Het
Grid2ip G A 5: 143,361,340 (GRCm39) A191T probably damaging Het
Helz2 T C 2: 180,874,597 (GRCm39) S1966G probably benign Het
Ipmk A G 10: 71,217,607 (GRCm39) K385E probably damaging Het
Itga11 G A 9: 62,662,493 (GRCm39) V489I probably benign Het
Klhl6 T C 16: 19,784,727 (GRCm39) K137R probably benign Het
Meis1 G A 11: 18,831,665 (GRCm39) Q458* probably null Het
Mst1r T C 9: 107,785,523 (GRCm39) S394P probably benign Het
Mus81 G T 19: 5,536,362 (GRCm39) H155Q probably benign Het
Neb G A 2: 52,154,134 (GRCm39) L2326F probably damaging Het
Nf1 C T 11: 79,286,685 (GRCm39) Q162* probably null Het
Nox4 T C 7: 86,945,074 (GRCm39) V79A probably benign Het
Or11g2 A T 14: 50,856,170 (GRCm39) I164F probably damaging Het
Or13a28 T A 7: 140,218,355 (GRCm39) I247N possibly damaging Het
Or5ae2 T A 7: 84,506,225 (GRCm39) I216N probably damaging Het
Or6d12 A T 6: 116,493,626 (GRCm39) Y296F probably damaging Het
Peg3 T A 7: 6,719,141 (GRCm39) D69V probably damaging Het
Pnp2 A G 14: 51,196,992 (GRCm39) E26G probably benign Het
Pnpt1 T A 11: 29,087,102 (GRCm39) C154S probably benign Het
Ppp1r26 C T 2: 28,342,800 (GRCm39) T810I probably benign Het
Ppp2r5b A G 19: 6,280,257 (GRCm39) S349P probably benign Het
Prdm4 C T 10: 85,740,129 (GRCm39) V424I probably benign Het
Rraga A G 4: 86,494,996 (GRCm39) I281V probably benign Het
Sall1 T C 8: 89,759,510 (GRCm39) E198G probably damaging Het
Serpina9 T C 12: 103,963,362 (GRCm39) D382G possibly damaging Het
Stt3b A G 9: 115,095,260 (GRCm39) V257A probably damaging Het
Taf2 A T 15: 54,925,568 (GRCm39) Y225N possibly damaging Het
Tlr3 A G 8: 45,851,202 (GRCm39) L41P probably damaging Het
Trappc12 A T 12: 28,787,751 (GRCm39) V444E probably benign Het
Trim34a T A 7: 103,897,287 (GRCm39) V117D possibly damaging Het
Ttbk1 A C 17: 46,787,725 (GRCm39) M259R probably benign Het
Ttll12 A G 15: 83,464,303 (GRCm39) V509A probably damaging Het
Ush2a G A 1: 188,581,273 (GRCm39) V3718M probably benign Het
Vps35 T A 8: 86,014,429 (GRCm39) E73D probably damaging Het
Zfp790 C T 7: 29,522,525 (GRCm39) probably benign Het
Other mutations in Nin
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Nin APN 12 70,076,862 (GRCm39) missense probably damaging 0.98
IGL00677:Nin APN 12 70,073,634 (GRCm39) missense probably damaging 1.00
IGL00823:Nin APN 12 70,061,567 (GRCm39) missense probably benign 0.01
IGL01103:Nin APN 12 70,103,532 (GRCm39) missense probably damaging 0.99
IGL01113:Nin APN 12 70,078,553 (GRCm39) missense probably damaging 1.00
IGL01420:Nin APN 12 70,092,188 (GRCm39) missense probably benign 0.08
IGL01556:Nin APN 12 70,089,962 (GRCm39) missense probably benign 0.01
IGL01663:Nin APN 12 70,090,439 (GRCm39) missense possibly damaging 0.72
IGL02002:Nin APN 12 70,109,473 (GRCm39) nonsense probably null
IGL02030:Nin APN 12 70,092,042 (GRCm39) missense probably damaging 1.00
IGL02202:Nin APN 12 70,102,210 (GRCm39) missense probably damaging 1.00
IGL02207:Nin APN 12 70,103,431 (GRCm39) missense probably damaging 0.99
IGL02257:Nin APN 12 70,149,465 (GRCm39) missense possibly damaging 0.71
IGL02394:Nin APN 12 70,090,805 (GRCm39) missense probably damaging 1.00
IGL02531:Nin APN 12 70,067,706 (GRCm39) missense probably benign 0.02
IGL03028:Nin APN 12 70,082,044 (GRCm39) missense probably benign 0.13
IGL03155:Nin APN 12 70,078,544 (GRCm39) missense probably damaging 1.00
IGL03197:Nin APN 12 70,073,584 (GRCm39) missense probably benign 0.03
IGL02835:Nin UTSW 12 70,103,512 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0131:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0132:Nin UTSW 12 70,097,915 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0211:Nin UTSW 12 70,061,649 (GRCm39) missense probably damaging 1.00
R0734:Nin UTSW 12 70,076,887 (GRCm39) missense probably benign 0.01
R0947:Nin UTSW 12 70,107,960 (GRCm39) missense probably damaging 1.00
R1085:Nin UTSW 12 70,067,736 (GRCm39) missense possibly damaging 0.91
R1367:Nin UTSW 12 70,090,703 (GRCm39) missense probably damaging 0.99
R1452:Nin UTSW 12 70,064,424 (GRCm39) nonsense probably null
R1518:Nin UTSW 12 70,061,547 (GRCm39) missense probably benign 0.27
R1566:Nin UTSW 12 70,101,253 (GRCm39) missense probably damaging 0.99
R1572:Nin UTSW 12 70,085,524 (GRCm39) missense probably damaging 1.00
R1583:Nin UTSW 12 70,078,512 (GRCm39) missense probably benign
R1584:Nin UTSW 12 70,089,443 (GRCm39) missense probably benign 0.03
R1699:Nin UTSW 12 70,092,337 (GRCm39) missense possibly damaging 0.87
R1699:Nin UTSW 12 70,077,712 (GRCm39) missense probably benign 0.40
R1765:Nin UTSW 12 70,089,665 (GRCm39) missense probably damaging 1.00
R1794:Nin UTSW 12 70,090,569 (GRCm39) nonsense probably null
R1952:Nin UTSW 12 70,077,700 (GRCm39) missense probably damaging 1.00
R2004:Nin UTSW 12 70,072,251 (GRCm39) missense probably benign 0.01
R2025:Nin UTSW 12 70,076,782 (GRCm39) missense probably damaging 1.00
R2060:Nin UTSW 12 70,089,192 (GRCm39) missense possibly damaging 0.64
R2213:Nin UTSW 12 70,092,128 (GRCm39) missense probably damaging 1.00
R2224:Nin UTSW 12 70,108,004 (GRCm39) missense probably damaging 1.00
R2247:Nin UTSW 12 70,101,319 (GRCm39) missense probably damaging 1.00
R2972:Nin UTSW 12 70,109,487 (GRCm39) missense probably damaging 1.00
R3776:Nin UTSW 12 70,085,456 (GRCm39) missense possibly damaging 0.71
R3881:Nin UTSW 12 70,089,315 (GRCm39) missense probably benign 0.00
R3930:Nin UTSW 12 70,125,016 (GRCm39) missense probably damaging 1.00
R3959:Nin UTSW 12 70,097,526 (GRCm39) missense probably damaging 1.00
R4229:Nin UTSW 12 70,097,984 (GRCm39) missense probably damaging 0.99
R4359:Nin UTSW 12 70,061,712 (GRCm39) missense probably benign 0.00
R4423:Nin UTSW 12 70,089,752 (GRCm39) missense probably damaging 1.00
R4461:Nin UTSW 12 70,089,359 (GRCm39) missense probably benign 0.37
R4639:Nin UTSW 12 70,085,375 (GRCm39) missense probably damaging 0.97
R4791:Nin UTSW 12 70,090,581 (GRCm39) missense possibly damaging 0.94
R4839:Nin UTSW 12 70,137,325 (GRCm39) missense possibly damaging 0.46
R4912:Nin UTSW 12 70,090,837 (GRCm39) missense probably damaging 1.00
R5712:Nin UTSW 12 70,089,543 (GRCm39) missense probably damaging 1.00
R5726:Nin UTSW 12 70,124,953 (GRCm39) missense probably damaging 1.00
R5804:Nin UTSW 12 70,092,375 (GRCm39) missense possibly damaging 0.58
R5874:Nin UTSW 12 70,077,692 (GRCm39) missense possibly damaging 0.94
R5992:Nin UTSW 12 70,092,298 (GRCm39) missense possibly damaging 0.83
R6077:Nin UTSW 12 70,066,006 (GRCm39) missense probably damaging 1.00
R6184:Nin UTSW 12 70,090,511 (GRCm39) missense probably damaging 1.00
R6307:Nin UTSW 12 70,061,631 (GRCm39) missense possibly damaging 0.91
R6315:Nin UTSW 12 70,092,389 (GRCm39) missense probably damaging 1.00
R6326:Nin UTSW 12 70,091,955 (GRCm39) missense possibly damaging 0.95
R6492:Nin UTSW 12 70,101,308 (GRCm39) missense probably benign 0.22
R6562:Nin UTSW 12 70,102,728 (GRCm39) missense probably damaging 1.00
R6578:Nin UTSW 12 70,107,968 (GRCm39) missense probably damaging 0.99
R6613:Nin UTSW 12 70,077,728 (GRCm39) missense probably damaging 1.00
R7112:Nin UTSW 12 70,149,573 (GRCm39) missense
R7170:Nin UTSW 12 70,091,013 (GRCm39) missense
R7324:Nin UTSW 12 70,090,508 (GRCm39) missense
R7338:Nin UTSW 12 70,090,838 (GRCm39) missense
R7372:Nin UTSW 12 70,102,803 (GRCm39) missense
R7431:Nin UTSW 12 70,124,997 (GRCm39) missense
R7577:Nin UTSW 12 70,109,480 (GRCm39) missense
R7655:Nin UTSW 12 70,089,542 (GRCm39) missense
R7656:Nin UTSW 12 70,089,542 (GRCm39) missense
R7683:Nin UTSW 12 70,124,956 (GRCm39) missense
R7769:Nin UTSW 12 70,090,004 (GRCm39) missense
R7981:Nin UTSW 12 70,089,591 (GRCm39) missense
R8138:Nin UTSW 12 70,089,672 (GRCm39) missense
R8141:Nin UTSW 12 70,076,795 (GRCm39) missense
R8754:Nin UTSW 12 70,077,787 (GRCm39) intron probably benign
R8790:Nin UTSW 12 70,067,793 (GRCm39) missense
R8899:Nin UTSW 12 70,077,710 (GRCm39) missense probably damaging 1.00
R8974:Nin UTSW 12 70,124,932 (GRCm39) missense
R9085:Nin UTSW 12 70,076,786 (GRCm39) nonsense probably null
R9143:Nin UTSW 12 70,137,349 (GRCm39) missense
R9380:Nin UTSW 12 70,074,805 (GRCm39) missense
R9496:Nin UTSW 12 70,102,762 (GRCm39) missense
R9638:Nin UTSW 12 70,067,618 (GRCm39) missense
R9709:Nin UTSW 12 70,149,468 (GRCm39) missense
R9745:Nin UTSW 12 70,089,899 (GRCm39) missense
R9792:Nin UTSW 12 70,094,009 (GRCm39) missense
Z1176:Nin UTSW 12 70,095,938 (GRCm39) critical splice acceptor site probably null
Z1177:Nin UTSW 12 70,101,200 (GRCm39) missense
Z1177:Nin UTSW 12 70,090,869 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- ATGCTGGCTCTCAGATGCGTTC -3'
(R):5'- AGCATTGTAGGAAGTGGTCCCATTG -3'

Sequencing Primer
(F):5'- TTCAGGTCTTGCAGCAGC -3'
(R):5'- AAGTGGTCCCATTGTCTGC -3'
Posted On 2014-03-28