Incidental Mutation 'R1477:Dock8'
ID 164162
Institutional Source Beutler Lab
Gene Symbol Dock8
Ensembl Gene ENSMUSG00000052085
Gene Name dedicator of cytokinesis 8
Synonyms A130095G14Rik, 5830472H07Rik, 1200017A24Rik
MMRRC Submission 039530-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1477 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 24999529-25202432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 25095550 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 398 (Y398F)
Ref Sequence ENSEMBL: ENSMUSP00000025831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025831]
AlphaFold Q8C147
PDB Structure Crystal structure of the DHR-2 domain of DOCK8 in complex with Cdc42 (T17N mutant) [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025831
AA Change: Y398F

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000025831
Gene: ENSMUSG00000052085
AA Change: Y398F

DomainStartEndE-ValueType
Pfam:DUF3398 71 164 3.9e-25 PFAM
Pfam:DOCK-C2 557 739 6.7e-49 PFAM
low complexity region 786 803 N/A INTRINSIC
low complexity region 1003 1020 N/A INTRINSIC
low complexity region 1123 1138 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1371 1383 N/A INTRINSIC
Pfam:DHR-2 1534 2060 5e-210 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DOCK180 family of guanine nucleotide exchange factors. Guanine nucleotide exchange factors interact with Rho GTPases and are components of intracellular signaling networks. Mutations in this gene result in the autosomal recessive form of the hyper-IgE syndrome. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(4) Chemically induced(2)

Mice homozygous for inactivating mutations of this gene exhibit loss of marginal zone B cells, decrease in peritoneal B1 cells and peripheral naive T cells, failure of sustained antibody response after immunization, failure of germinal center persistence, and failure of B cell affinity maturation.

Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik C A 7: 28,157,093 Q2102K probably benign Het
Acsl5 A C 19: 55,291,472 D481A probably benign Het
Adam2 A C 14: 66,077,700 L8R possibly damaging Het
Arfgef1 A T 1: 10,189,284 C619S probably damaging Het
Atm A G 9: 53,464,273 I2082T probably benign Het
Cgrrf1 A G 14: 46,853,438 I210M probably benign Het
Clec2e A T 6: 129,095,200 V72E probably benign Het
Cmtr1 T C 17: 29,697,157 V587A possibly damaging Het
Col1a2 T C 6: 4,539,673 F1314L unknown Het
Ctbp2 T C 7: 132,998,941 E618G probably damaging Het
Ezh1 A T 11: 101,192,984 D733E probably damaging Het
Fbxl6 A G 15: 76,537,734 S202P probably benign Het
Gm996 G C 2: 25,579,753 H49D possibly damaging Het
Grid2ip G A 5: 143,375,585 A191T probably damaging Het
Helz2 T C 2: 181,232,804 S1966G probably benign Het
Ipmk A G 10: 71,381,777 K385E probably damaging Het
Itga11 G A 9: 62,755,211 V489I probably benign Het
Klhl6 T C 16: 19,965,977 K137R probably benign Het
Meis1 G A 11: 18,881,665 Q458* probably null Het
Mst1r T C 9: 107,908,324 S394P probably benign Het
Mus81 G T 19: 5,486,334 H155Q probably benign Het
Neb G A 2: 52,264,122 L2326F probably damaging Het
Nf1 C T 11: 79,395,859 Q162* probably null Het
Nin T C 12: 70,044,184 E819G possibly damaging Het
Nox4 T C 7: 87,295,866 V79A probably benign Het
Olfr212 A T 6: 116,516,665 Y296F probably damaging Het
Olfr291 T A 7: 84,857,017 I216N probably damaging Het
Olfr61 T A 7: 140,638,442 I247N possibly damaging Het
Olfr744 A T 14: 50,618,713 I164F probably damaging Het
Peg3 T A 7: 6,716,142 D69V probably damaging Het
Pih1d3 G A 1: 31,223,023 V29M probably benign Het
Pnp2 A G 14: 50,959,535 E26G probably benign Het
Pnpt1 T A 11: 29,137,102 C154S probably benign Het
Ppp1r26 C T 2: 28,452,788 T810I probably benign Het
Ppp2r5b A G 19: 6,230,227 S349P probably benign Het
Prdm4 C T 10: 85,904,265 V424I probably benign Het
Rraga A G 4: 86,576,759 I281V probably benign Het
Sall1 T C 8: 89,032,882 E198G probably damaging Het
Serpina9 T C 12: 103,997,103 D382G possibly damaging Het
Stt3b A G 9: 115,266,192 V257A probably damaging Het
Taf2 A T 15: 55,062,172 Y225N possibly damaging Het
Tlr3 A G 8: 45,398,165 L41P probably damaging Het
Trappc12 A T 12: 28,737,752 V444E probably benign Het
Trim34a T A 7: 104,248,080 V117D possibly damaging Het
Ttbk1 A C 17: 46,476,799 M259R probably benign Het
Ttll12 A G 15: 83,580,102 V509A probably damaging Het
Ush2a G A 1: 188,849,076 V3718M probably benign Het
Vps35 T A 8: 85,287,800 E73D probably damaging Het
Zfp790 C T 7: 29,823,100 probably benign Het
Other mutations in Dock8
AlleleSourceChrCoordTypePredicted EffectPPH Score
captain_morgan APN 19 25127712 critical splice donor site probably benign
primurus APN 19 25183609 missense probably damaging 1.00
IGL00737:Dock8 APN 19 25182976 missense probably benign 0.00
IGL00755:Dock8 APN 19 25051509 missense probably benign 0.09
IGL00822:Dock8 APN 19 25188409 nonsense probably null
IGL00838:Dock8 APN 19 25175459 nonsense probably null
IGL01419:Dock8 APN 19 25119452 missense probably benign 0.08
IGL01456:Dock8 APN 19 25119499 missense possibly damaging 0.95
IGL01532:Dock8 APN 19 25169441 missense probably damaging 0.99
IGL01602:Dock8 APN 19 25089888 splice site probably benign
IGL01605:Dock8 APN 19 25089888 splice site probably benign
IGL01753:Dock8 APN 19 25061292 splice site probably benign
IGL01843:Dock8 APN 19 25089928 missense probably benign 0.02
IGL02032:Dock8 APN 19 25130405 missense probably damaging 0.99
IGL02073:Dock8 APN 19 25200986 critical splice acceptor site probably null
IGL02192:Dock8 APN 19 25078205 critical splice donor site probably null
IGL02402:Dock8 APN 19 25078145 missense probably benign 0.25
IGL02529:Dock8 APN 19 25100926 nonsense probably null
IGL02728:Dock8 APN 19 25132220 missense probably benign
IGL02739:Dock8 APN 19 25188488 missense probably damaging 1.00
IGL03037:Dock8 APN 19 25086181 missense probably benign 0.02
IGL03104:Dock8 APN 19 25201020 nonsense probably null
IGL03137:Dock8 APN 19 25155948 missense probably benign 0.19
IGL03365:Dock8 APN 19 25099684 missense possibly damaging 0.70
Defenseless UTSW 19 25051563 missense probably benign 0.00
Guardate UTSW 19 25149831 missense probably benign
hillock UTSW 19 25174333 critical splice donor site probably null
Molehill UTSW 19 25130461 missense probably damaging 1.00
Pap UTSW 19 25122441 missense probably benign 0.31
Papilla UTSW 19 25078084 nonsense probably null
snowdrop UTSW 19 25184941 critical splice donor site probably null
warts_and_all UTSW 19 25169501 critical splice donor site probably null
R0021:Dock8 UTSW 19 25163047 missense probably benign 0.01
R0147:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0148:Dock8 UTSW 19 25119459 missense probably benign 0.00
R0294:Dock8 UTSW 19 25188350 missense probably damaging 1.00
R0537:Dock8 UTSW 19 25171577 missense probably benign 0.08
R0630:Dock8 UTSW 19 25061160 missense probably benign 0.10
R1163:Dock8 UTSW 19 25051503 missense probably benign
R1164:Dock8 UTSW 19 25090027 missense probably benign 0.44
R1471:Dock8 UTSW 19 25201036 missense possibly damaging 0.74
R1633:Dock8 UTSW 19 25051563 missense probably benign 0.00
R1803:Dock8 UTSW 19 25132235 missense probably benign 0.00
R1822:Dock8 UTSW 19 25161058 missense probably benign 0.31
R1852:Dock8 UTSW 19 25127128 missense probably benign 0.45
R1916:Dock8 UTSW 19 25061157 missense probably benign 0.02
R1984:Dock8 UTSW 19 25121181 missense probably null
R2311:Dock8 UTSW 19 25183004 missense possibly damaging 0.93
R2341:Dock8 UTSW 19 25200393 missense probably damaging 0.99
R2483:Dock8 UTSW 19 25079877 missense probably benign
R3116:Dock8 UTSW 19 25188494 missense probably benign 0.00
R3157:Dock8 UTSW 19 25149831 missense probably benign
R3623:Dock8 UTSW 19 25079877 missense probably benign
R3624:Dock8 UTSW 19 25079877 missense probably benign
R3800:Dock8 UTSW 19 25164352 missense probably benign 0.08
R3844:Dock8 UTSW 19 25065430 nonsense probably null
R3895:Dock8 UTSW 19 25051501 missense probably benign 0.31
R3901:Dock8 UTSW 19 25100905 missense possibly damaging 0.69
R3959:Dock8 UTSW 19 25184941 critical splice donor site probably null
R4428:Dock8 UTSW 19 25200499 missense probably damaging 0.98
R4428:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4429:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4431:Dock8 UTSW 19 25065390 missense probably benign 0.00
R4545:Dock8 UTSW 19 25188358 missense probably damaging 1.00
R4839:Dock8 UTSW 19 25169494 missense probably benign 0.00
R4897:Dock8 UTSW 19 25181637 missense probably benign 0.00
R4939:Dock8 UTSW 19 25122400 missense probably damaging 1.00
R4995:Dock8 UTSW 19 25158383 missense probably benign 0.02
R5035:Dock8 UTSW 19 25086207 missense probably damaging 0.99
R5294:Dock8 UTSW 19 25061153 missense probably benign 0.01
R5324:Dock8 UTSW 19 25163094 missense probably benign 0.17
R5478:Dock8 UTSW 19 25079822 missense probably benign
R5704:Dock8 UTSW 19 25174222 missense probably damaging 1.00
R5724:Dock8 UTSW 19 25122421 missense probably damaging 1.00
R5745:Dock8 UTSW 19 25130397 missense probably benign 0.02
R5864:Dock8 UTSW 19 25061220 missense probably damaging 0.99
R5870:Dock8 UTSW 19 25132126 missense probably benign
R5893:Dock8 UTSW 19 25122447 missense probably damaging 1.00
R5954:Dock8 UTSW 19 25171619 missense probably damaging 1.00
R6087:Dock8 UTSW 19 25161074 missense probably benign 0.00
R6223:Dock8 UTSW 19 25161052 missense probably benign 0.00
R6391:Dock8 UTSW 19 25095550 missense possibly damaging 0.95
R6759:Dock8 UTSW 19 25127484 missense probably damaging 0.99
R6786:Dock8 UTSW 19 25183022 missense possibly damaging 0.49
R6794:Dock8 UTSW 19 25122441 missense probably benign 0.31
R6818:Dock8 UTSW 19 25169501 critical splice donor site probably null
R6885:Dock8 UTSW 19 25147378 missense possibly damaging 0.95
R6908:Dock8 UTSW 19 25188382 missense probably damaging 1.00
R6923:Dock8 UTSW 19 25095606 missense probably benign
R7001:Dock8 UTSW 19 25099677 missense probably benign
R7141:Dock8 UTSW 19 25181620 missense probably null 0.75
R7203:Dock8 UTSW 19 25181563 missense probably damaging 1.00
R7257:Dock8 UTSW 19 25127085 missense probably benign 0.08
R7296:Dock8 UTSW 19 25184881 missense probably benign 0.00
R7538:Dock8 UTSW 19 25158418 missense probably damaging 1.00
R7555:Dock8 UTSW 19 25175400 missense probably damaging 0.99
R7641:Dock8 UTSW 19 25174333 critical splice donor site probably null
R7764:Dock8 UTSW 19 25097535 missense probably benign
R7859:Dock8 UTSW 19 25183570 missense probably damaging 1.00
R7864:Dock8 UTSW 19 25163500 missense possibly damaging 0.95
R8090:Dock8 UTSW 19 25154242 missense probably damaging 1.00
R8160:Dock8 UTSW 19 25147347 missense probably damaging 1.00
R8287:Dock8 UTSW 19 25130461 missense probably damaging 1.00
R8295:Dock8 UTSW 19 25123236 missense probably benign 0.04
R8443:Dock8 UTSW 19 25155917 missense probably benign 0.04
R8537:Dock8 UTSW 19 25130506 missense probably benign 0.00
R8673:Dock8 UTSW 19 25183503 missense probably damaging 0.96
R8709:Dock8 UTSW 19 25078084 nonsense probably null
R8834:Dock8 UTSW 19 25163470 missense probably benign 0.16
R8991:Dock8 UTSW 19 25188367 missense possibly damaging 0.82
R9292:Dock8 UTSW 19 25183631 splice site probably benign
R9509:Dock8 UTSW 19 25095621 missense probably benign 0.00
R9526:Dock8 UTSW 19 25188375 missense probably benign 0.10
R9622:Dock8 UTSW 19 25121181 missense probably null
R9634:Dock8 UTSW 19 25192221 missense probably damaging 1.00
R9654:Dock8 UTSW 19 25147346 missense probably damaging 1.00
R9670:Dock8 UTSW 19 25171562 missense probably null 0.01
R9699:Dock8 UTSW 19 25156024 critical splice donor site probably null
R9726:Dock8 UTSW 19 25177010 missense probably damaging 0.97
R9765:Dock8 UTSW 19 25169468 missense possibly damaging 0.94
X0027:Dock8 UTSW 19 25161129 missense probably benign
Z1177:Dock8 UTSW 19 25132123 missense probably benign 0.05
Z1177:Dock8 UTSW 19 25155972 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCATGTTGGCTGCTGTAACAAGC -3'
(R):5'- TTGTTTCGGGGTCACTGACCAAG -3'

Sequencing Primer
(F):5'- AGACTTCAGCCTAAACTGTTGC -3'
(R):5'- TTCTCAAGTCCTTACTAATGAGCAG -3'
Posted On 2014-03-28