Mutagenetix > Incidental Mutations

Incidental Mutation 'R1479:Tnrc6b'

164235

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

039532-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R1479 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 80887032 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153748 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689] [ENSMUST00000227449]

AlphaFold

Q8BKI2

Predicted Effect

probably damaging
Transcript: ENSMUST00000067689
AA Change: L1106Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: L1106Q

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000227449

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227546

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228071

Predicted Effect

probably damaging
Transcript: ENSMUST00000228124
AA Change: L253Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228320

Meta Mutation Damage Score

0.1614

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.3%

Validation Efficiency

96% (81/84)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110008L16Rik	T	A	12: 55,379,387	D138E	probably damaging	Het
1700022I11Rik	A	C	4: 42,972,543	K625N	possibly damaging	Het
2310030G06Rik	T	A	9: 50,741,301	T58S	possibly damaging	Het
4930432K21Rik	C	A	8: 84,162,397	T123K	possibly damaging	Het
Alox12e	A	G	11: 70,320,782	V252A	probably benign	Het
Anks6	T	C	4: 47,044,874	D344G	probably damaging	Het
Atg14	A	T	14: 47,547,239		probably null	Het
BC052040	T	A	2: 115,639,013	N74K	probably benign	Het
Bcr	G	T	10: 75,061,125	E34*	probably null	Het
Birc6	C	T	17: 74,634,853	T2728M	probably damaging	Het
Bmp2k	T	A	5: 97,053,200	N326K	probably benign	Het
Ccdc188	A	C	16: 18,219,290	T242P	possibly damaging	Het
Chsy3	A	T	18: 59,408,913	E374D	probably benign	Het
Clca4b	A	T	3: 144,915,468	V615E	probably damaging	Het
Clcnka	C	A	4: 141,389,447	A498S	possibly damaging	Het
Csmd3	A	G	15: 47,857,886	C1450R	probably damaging	Het
Cul7	C	A	17: 46,651,747	D101E	probably damaging	Het
Cyp27b1	G	A	10: 127,051,711		probably null	Het
Cyp2d22	A	G	15: 82,371,936	S404P	probably damaging	Het
Dclk3	G	A	9: 111,468,546	S386N	probably benign	Het
Dnah10	G	A	5: 124,777,889	D1953N	possibly damaging	Het
Dst	T	A	1: 34,264,515		probably null	Het
Egfem1	A	G	3: 29,657,165	N241D	probably damaging	Het
Entpd7	T	C	19: 43,721,840	F312S	probably damaging	Het
Esp34	T	A	17: 38,554,328		probably benign	Het
Fam126b	T	A	1: 58,552,268	R91*	probably null	Het
Foxd2	T	A	4: 114,907,918	T302S	unknown	Het
Fzd6	A	T	15: 39,030,999	N187Y	probably damaging	Het
Gbp9	C	T	5: 105,094,064		probably benign	Het
Gm11492	G	T	11: 87,567,418	R206L	probably damaging	Het
Gna14	T	C	19: 16,533,769	S61P	possibly damaging	Het
Grap	A	T	11: 61,660,298	Y52F	probably benign	Het
H2-T3	T	C	17: 36,189,428	Y125C	probably damaging	Het
Hax1	C	A	3: 89,995,857	E212D	probably damaging	Het
Hecw1	A	C	13: 14,316,492	S638R	probably benign	Het
Hira	A	T	16: 18,896,469	K39M	probably damaging	Het
Hoxa2	T	A	6: 52,163,340	D222V	probably damaging	Het
Jph2	C	T	2: 163,339,271	V658M	possibly damaging	Het
Kansl1	A	T	11: 104,342,416	S762T	probably damaging	Het
Kat6b	T	A	14: 21,618,956	C267S	probably benign	Het
Klk6	A	G	7: 43,831,634	N250S	probably benign	Het
Lbp	T	C	2: 158,319,714	L232S	probably damaging	Het
Lcn9	A	T	2: 25,823,703		probably benign	Het
Lcp2	A	G	11: 34,075,068	H213R	probably benign	Het
Lrrc9	A	T	12: 72,460,825	K367*	probably null	Het
Lyst	A	G	13: 13,634,482	I246V	probably benign	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mst1r	T	C	9: 107,913,345		probably benign	Het
Myo18a	A	G	11: 77,842,194	E909G	probably benign	Het
Nipbl	A	T	15: 8,350,289	D1006E	probably benign	Het
Olfr1164	A	G	2: 88,093,286	F217L	probably benign	Het
Olfr729	C	A	14: 50,148,788	V29F	probably benign	Het
Olfr933	A	T	9: 38,975,762	I29F	probably benign	Het
Otog	A	G	7: 46,295,978	I2220V	possibly damaging	Het
Pcx	T	A	19: 4,602,024	I99N	probably damaging	Het
Pi4ka	C	T	16: 17,373,400	G211D	probably benign	Het
Pp2d1	T	C	17: 53,507,855	S614G	probably benign	Het
Prdx6	G	A	1: 161,244,263	A111V	probably damaging	Het
Prss51	G	A	14: 64,096,170		probably null	Het
Psmd6	C	T	14: 14,116,819		probably benign	Het
Pten	T	A	19: 32,819,850	L345Q	probably damaging	Het
Qrich2	T	G	11: 116,441,485	H2295P	probably benign	Het
Rgs11	T	C	17: 26,208,283		probably null	Het
Rgs6	A	G	12: 83,116,244	E408G	probably damaging	Het
Slc38a7	T	C	8: 95,848,494	T53A	probably benign	Het
Sptbn1	A	G	11: 30,113,909	C1957R	probably damaging	Het
Sumf1	T	C	6: 108,176,058	Y123C	probably damaging	Het
Ttc21a	C	A	9: 119,956,947	D670E	probably benign	Het
Ttn	A	G	2: 76,744,511	V25346A	probably damaging	Het
Ubr4	A	G	4: 139,425,840	T2070A	possibly damaging	Het
Vmn2r57	C	A	7: 41,427,830	W304L	possibly damaging	Het
Vps13a	T	C	19: 16,750,114		probably benign	Het
Wisp3	G	A	10: 39,153,243	R230W	probably damaging	Het
Zfp647	A	G	15: 76,911,203	V419A	possibly damaging	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7287:Tnrc6b	UTSW	15	80879541	missense	possibly damaging	0.83
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- GGTGAACTCTCAGCTTTGCATTTTCAG -3'
(R):5'- ACATCAGTACAGCTATGGACAGAGGAC -3'

Sequencing Primer
(F):5'- GCATTTTCAGTGTGGTTTATAGTTTG -3'
(R):5'- aaaaatGATGTGCAGACACTAGTAAC -3'

Posted On

2014-03-28