Incidental Mutation 'R1479:Pi4ka'
ID164237
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1479 (G1)
Quality Score197
Status Validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17373400 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 211 (G211D)
Ref Sequence ENSEMBL: ENSMUSP00000156049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000232232]
Predicted Effect probably benign
Transcript: ENSMUST00000036161
AA Change: G211D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: G211D

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128938
Predicted Effect probably benign
Transcript: ENSMUST00000154364
AA Change: G211D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: G211D

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231419
Predicted Effect probably benign
Transcript: ENSMUST00000232232
AA Change: G211D

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.176 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
R6720_Pi4ka_560 UTSW 16 17326052 splice site probably null
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATAACAGAGGGTCAGTCCCAGCC -3'
(R):5'- GTCTCCTCAGAAACCTCACATGCAC -3'

Sequencing Primer
(F):5'- CTCCTCAACATCATAAGAAATCACTG -3'
(R):5'- acacctgtaatcccaacactc -3'
Posted On2014-03-28