Incidental Mutation 'R1479:Pi4ka'
ID164237
Institutional Source Beutler Lab
Gene Symbol Pi4ka
Ensembl Gene ENSMUSG00000041720
Gene Namephosphatidylinositol 4-kinase alpha
SynonymsPik4ca
MMRRC Submission 039532-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1479 (G1)
Quality Score197
Status Validated
Chromosome16
Chromosomal Location17280351-17406314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17373400 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 211 (G211D)
Ref Sequence ENSEMBL: ENSMUSP00000156049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036161] [ENSMUST00000154364] [ENSMUST00000232232]
Predicted Effect probably benign
Transcript: ENSMUST00000036161
AA Change: G211D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000036162
Gene: ENSMUSG00000041720
AA Change: G211D

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128938
Predicted Effect probably benign
Transcript: ENSMUST00000154364
AA Change: G211D

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000122550
Gene: ENSMUSG00000041720
AA Change: G211D

DomainStartEndE-ValueType
low complexity region 198 221 N/A INTRINSIC
low complexity region 243 253 N/A INTRINSIC
SCOP:d1gw5a_ 268 675 2e-3 SMART
low complexity region 895 907 N/A INTRINSIC
PI3Ka 1483 1671 2.11e-54 SMART
Blast:PI3Kc 1688 1762 2e-39 BLAST
PI3Kc 1788 2041 4.04e-106 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231419
Predicted Effect probably benign
Transcript: ENSMUST00000232232
AA Change: G211D

PolyPhen 2 Score 0.077 (Sensitivity: 0.93; Specificity: 0.85)
Meta Mutation Damage Score 0.0993 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.3%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol (PI) 4-kinase which catalyzes the first committed step in the biosynthesis of phosphatidylinositol 4,5-bisphosphate. The mammalian PI 4-kinases have been classified into two types, II and III, based on their molecular mass, and modulation by detergent and adenosine. The protein encoded by this gene is a type III enzyme that is not inhibited by adenosine. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a targeted knock-out or knock-in conditionally activated exhibit premature death associated with degeneration of mucosal cells in the stomach and intestines. Mice homozygous for a knock-out allele exhibit early embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik T A 12: 55,379,387 D138E probably damaging Het
1700022I11Rik A C 4: 42,972,543 K625N possibly damaging Het
2310030G06Rik T A 9: 50,741,301 T58S possibly damaging Het
4930432K21Rik C A 8: 84,162,397 T123K possibly damaging Het
Alox12e A G 11: 70,320,782 V252A probably benign Het
Anks6 T C 4: 47,044,874 D344G probably damaging Het
Atg14 A T 14: 47,547,239 probably null Het
BC052040 T A 2: 115,639,013 N74K probably benign Het
Bcr G T 10: 75,061,125 E34* probably null Het
Birc6 C T 17: 74,634,853 T2728M probably damaging Het
Bmp2k T A 5: 97,053,200 N326K probably benign Het
Ccdc188 A C 16: 18,219,290 T242P possibly damaging Het
Chsy3 A T 18: 59,408,913 E374D probably benign Het
Clca4b A T 3: 144,915,468 V615E probably damaging Het
Clcnka C A 4: 141,389,447 A498S possibly damaging Het
Csmd3 A G 15: 47,857,886 C1450R probably damaging Het
Cul7 C A 17: 46,651,747 D101E probably damaging Het
Cyp27b1 G A 10: 127,051,711 probably null Het
Cyp2d22 A G 15: 82,371,936 S404P probably damaging Het
Dclk3 G A 9: 111,468,546 S386N probably benign Het
Dnah10 G A 5: 124,777,889 D1953N possibly damaging Het
Dst T A 1: 34,264,515 probably null Het
Egfem1 A G 3: 29,657,165 N241D probably damaging Het
Entpd7 T C 19: 43,721,840 F312S probably damaging Het
Esp34 T A 17: 38,554,328 probably benign Het
Fam126b T A 1: 58,552,268 R91* probably null Het
Foxd2 T A 4: 114,907,918 T302S unknown Het
Fzd6 A T 15: 39,030,999 N187Y probably damaging Het
Gbp9 C T 5: 105,094,064 probably benign Het
Gm11492 G T 11: 87,567,418 R206L probably damaging Het
Gna14 T C 19: 16,533,769 S61P possibly damaging Het
Grap A T 11: 61,660,298 Y52F probably benign Het
H2-T3 T C 17: 36,189,428 Y125C probably damaging Het
Hax1 C A 3: 89,995,857 E212D probably damaging Het
Hecw1 A C 13: 14,316,492 S638R probably benign Het
Hira A T 16: 18,896,469 K39M probably damaging Het
Hoxa2 T A 6: 52,163,340 D222V probably damaging Het
Jph2 C T 2: 163,339,271 V658M possibly damaging Het
Kansl1 A T 11: 104,342,416 S762T probably damaging Het
Kat6b T A 14: 21,618,956 C267S probably benign Het
Klk6 A G 7: 43,831,634 N250S probably benign Het
Lbp T C 2: 158,319,714 L232S probably damaging Het
Lcn9 A T 2: 25,823,703 probably benign Het
Lcp2 A G 11: 34,075,068 H213R probably benign Het
Lrrc9 A T 12: 72,460,825 K367* probably null Het
Lyst A G 13: 13,634,482 I246V probably benign Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mst1r T C 9: 107,913,345 probably benign Het
Myo18a A G 11: 77,842,194 E909G probably benign Het
Nipbl A T 15: 8,350,289 D1006E probably benign Het
Olfr1164 A G 2: 88,093,286 F217L probably benign Het
Olfr729 C A 14: 50,148,788 V29F probably benign Het
Olfr933 A T 9: 38,975,762 I29F probably benign Het
Otog A G 7: 46,295,978 I2220V possibly damaging Het
Pcx T A 19: 4,602,024 I99N probably damaging Het
Pp2d1 T C 17: 53,507,855 S614G probably benign Het
Prdx6 G A 1: 161,244,263 A111V probably damaging Het
Prss51 G A 14: 64,096,170 probably null Het
Psmd6 C T 14: 14,116,819 probably benign Het
Pten T A 19: 32,819,850 L345Q probably damaging Het
Qrich2 T G 11: 116,441,485 H2295P probably benign Het
Rgs11 T C 17: 26,208,283 probably null Het
Rgs6 A G 12: 83,116,244 E408G probably damaging Het
Slc38a7 T C 8: 95,848,494 T53A probably benign Het
Sptbn1 A G 11: 30,113,909 C1957R probably damaging Het
Sumf1 T C 6: 108,176,058 Y123C probably damaging Het
Tnrc6b T A 15: 80,887,032 probably null Het
Ttc21a C A 9: 119,956,947 D670E probably benign Het
Ttn A G 2: 76,744,511 V25346A probably damaging Het
Ubr4 A G 4: 139,425,840 T2070A possibly damaging Het
Vmn2r57 C A 7: 41,427,830 W304L possibly damaging Het
Vps13a T C 19: 16,750,114 probably benign Het
Wisp3 G A 10: 39,153,243 R230W probably damaging Het
Zfp647 A G 15: 76,911,203 V419A possibly damaging Het
Other mutations in Pi4ka
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00580:Pi4ka APN 16 17308144 missense probably benign
IGL00984:Pi4ka APN 16 17358932 nonsense probably null
IGL01066:Pi4ka APN 16 17348773 splice site probably benign
IGL01460:Pi4ka APN 16 17357651 missense probably damaging 1.00
IGL01505:Pi4ka APN 16 17309358 missense probably benign 0.22
IGL01518:Pi4ka APN 16 17280735 missense probably benign 0.03
IGL01533:Pi4ka APN 16 17308201 missense probably benign 0.30
IGL01565:Pi4ka APN 16 17389442 utr 5 prime probably benign
IGL01679:Pi4ka APN 16 17296888 splice site probably benign
IGL01685:Pi4ka APN 16 17325202 missense probably benign 0.09
IGL01734:Pi4ka APN 16 17297260 missense probably benign 0.23
IGL01799:Pi4ka APN 16 17389371 missense probably damaging 1.00
IGL01969:Pi4ka APN 16 17378483 missense probably benign 0.15
IGL02092:Pi4ka APN 16 17318496 missense probably benign 0.00
IGL02113:Pi4ka APN 16 17373415 missense probably benign 0.00
IGL02177:Pi4ka APN 16 17318282 missense probably benign 0.09
IGL02400:Pi4ka APN 16 17293884 missense probably damaging 0.98
IGL02426:Pi4ka APN 16 17378432 splice site probably benign
IGL02474:Pi4ka APN 16 17325429 missense probably damaging 1.00
IGL02587:Pi4ka APN 16 17317353 missense probably damaging 1.00
IGL02667:Pi4ka APN 16 17295461 missense possibly damaging 0.82
IGL02698:Pi4ka APN 16 17291168 missense probably damaging 1.00
IGL02815:Pi4ka APN 16 17358889 splice site probably benign
IGL02828:Pi4ka APN 16 17280711 intron probably benign
IGL02939:Pi4ka APN 16 17354210 missense probably damaging 0.97
IGL03123:Pi4ka APN 16 17282675 missense possibly damaging 0.95
IGL03148:Pi4ka APN 16 17354189 missense probably damaging 0.99
arachnoid UTSW 16 17285281 unclassified probably benign
dove_bar UTSW 16 17326052 splice site probably null
mia UTSW 16 17376982 missense possibly damaging 0.89
pia UTSW 16 17281044 missense probably damaging 1.00
IGL03098:Pi4ka UTSW 16 17326027 missense probably damaging 1.00
R0024:Pi4ka UTSW 16 17315535 splice site probably benign
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0054:Pi4ka UTSW 16 17325114 missense probably null 1.00
R0243:Pi4ka UTSW 16 17297635 missense probably benign 0.44
R0374:Pi4ka UTSW 16 17282932 unclassified probably benign
R0478:Pi4ka UTSW 16 17309311 missense possibly damaging 0.92
R0548:Pi4ka UTSW 16 17307718 missense possibly damaging 0.75
R0626:Pi4ka UTSW 16 17293901 missense probably benign 0.00
R0918:Pi4ka UTSW 16 17285260 missense possibly damaging 0.61
R1082:Pi4ka UTSW 16 17389352 missense probably damaging 1.00
R1384:Pi4ka UTSW 16 17297537 splice site probably benign
R1455:Pi4ka UTSW 16 17363954 missense probably benign 0.02
R1490:Pi4ka UTSW 16 17386268 missense probably damaging 1.00
R1565:Pi4ka UTSW 16 17281900 missense probably null
R1594:Pi4ka UTSW 16 17373419 splice site probably benign
R1641:Pi4ka UTSW 16 17377030 missense probably benign 0.00
R1694:Pi4ka UTSW 16 17295376 missense probably damaging 0.99
R1828:Pi4ka UTSW 16 17280750 missense probably benign 0.00
R1864:Pi4ka UTSW 16 17367525 nonsense probably null
R2036:Pi4ka UTSW 16 17303112 missense probably damaging 1.00
R2151:Pi4ka UTSW 16 17367507 missense probably benign 0.44
R2844:Pi4ka UTSW 16 17350793 missense probably damaging 0.97
R2876:Pi4ka UTSW 16 17367550 missense possibly damaging 0.77
R3953:Pi4ka UTSW 16 17285281 unclassified probably benign
R3972:Pi4ka UTSW 16 17293875 missense probably damaging 1.00
R4357:Pi4ka UTSW 16 17367439 missense probably benign 0.00
R4385:Pi4ka UTSW 16 17386265 missense probably benign 0.13
R4427:Pi4ka UTSW 16 17281044 missense probably damaging 1.00
R4436:Pi4ka UTSW 16 17282382 missense probably damaging 1.00
R4677:Pi4ka UTSW 16 17282373 missense probably damaging 1.00
R4683:Pi4ka UTSW 16 17297037 missense possibly damaging 0.73
R4736:Pi4ka UTSW 16 17377175 missense probably benign 0.12
R4804:Pi4ka UTSW 16 17308161 missense possibly damaging 0.75
R4886:Pi4ka UTSW 16 17358361 missense probably damaging 0.98
R4893:Pi4ka UTSW 16 17377036 missense probably benign 0.21
R4896:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5004:Pi4ka UTSW 16 17377169 missense probably damaging 1.00
R5015:Pi4ka UTSW 16 17303082 missense possibly damaging 0.56
R5062:Pi4ka UTSW 16 17309397 missense probably benign 0.02
R5104:Pi4ka UTSW 16 17281050 missense probably damaging 1.00
R5160:Pi4ka UTSW 16 17323053 missense probably benign 0.01
R5173:Pi4ka UTSW 16 17350906 missense possibly damaging 0.95
R5204:Pi4ka UTSW 16 17359045 missense possibly damaging 0.68
R5307:Pi4ka UTSW 16 17323030 missense probably benign 0.00
R5327:Pi4ka UTSW 16 17325413 missense probably damaging 1.00
R5506:Pi4ka UTSW 16 17293953 missense probably damaging 0.96
R5580:Pi4ka UTSW 16 17281087 missense probably damaging 1.00
R5768:Pi4ka UTSW 16 17354872 missense probably benign 0.29
R5857:Pi4ka UTSW 16 17358984 missense probably benign 0.00
R5951:Pi4ka UTSW 16 17303142 missense probably damaging 1.00
R5953:Pi4ka UTSW 16 17281951 missense probably damaging 1.00
R6041:Pi4ka UTSW 16 17360572 missense probably benign
R6223:Pi4ka UTSW 16 17357571 nonsense probably null
R6416:Pi4ka UTSW 16 17358322 missense probably benign 0.22
R6535:Pi4ka UTSW 16 17301036 missense probably damaging 1.00
R6580:Pi4ka UTSW 16 17350830 missense probably damaging 1.00
R6720:Pi4ka UTSW 16 17326052 splice site probably null
R6723:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6725:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6752:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6753:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6755:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6767:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6768:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6782:Pi4ka UTSW 16 17325988 missense probably damaging 1.00
R6782:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6788:Pi4ka UTSW 16 17376982 missense possibly damaging 0.89
R6849:Pi4ka UTSW 16 17303421 missense possibly damaging 0.54
R6958:Pi4ka UTSW 16 17325227 missense probably damaging 1.00
R7014:Pi4ka UTSW 16 17297067 unclassified probably benign
R7055:Pi4ka UTSW 16 17317015 utr 3 prime probably benign
R7317:Pi4ka UTSW 16 17405632 critical splice donor site probably null
R7533:Pi4ka UTSW 16 17297661 missense
R7552:Pi4ka UTSW 16 17291216 missense
R7581:Pi4ka UTSW 16 17301060 missense
R7622:Pi4ka UTSW 16 17293977 missense
R7717:Pi4ka UTSW 16 17376923 missense
R8048:Pi4ka UTSW 16 17303127 missense
R8052:Pi4ka UTSW 16 17356166 missense
RF007:Pi4ka UTSW 16 17297233 missense
U24488:Pi4ka UTSW 16 17325176 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ATAACAGAGGGTCAGTCCCAGCC -3'
(R):5'- GTCTCCTCAGAAACCTCACATGCAC -3'

Sequencing Primer
(F):5'- CTCCTCAACATCATAAGAAATCACTG -3'
(R):5'- acacctgtaatcccaacactc -3'
Posted On2014-03-28