Incidental Mutation 'R1480:Nfyc'
ID164269
Institutional Source Beutler Lab
Gene Symbol Nfyc
Ensembl Gene ENSMUSG00000032897
Gene Namenuclear transcription factor-Y gamma
Synonyms
MMRRC Submission 039533-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R1480 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location120757438-120831572 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 120768724 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043429] [ENSMUST00000097906] [ENSMUST00000118902] [ENSMUST00000120779] [ENSMUST00000134979] [ENSMUST00000136236]
Predicted Effect probably null
Transcript: ENSMUST00000043429
SMART Domains Protein: ENSMUSP00000047441
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083475
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083556
Predicted Effect probably null
Transcript: ENSMUST00000097906
SMART Domains Protein: ENSMUSP00000095516
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
Pfam:Histone 9 107 7.2e-17 PFAM
Pfam:CBFD_NFYB_HMF 41 105 7.8e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118902
SMART Domains Protein: ENSMUSP00000112610
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000120779
SMART Domains Protein: ENSMUSP00000112810
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:Histone 36 107 2.5e-13 PFAM
Pfam:CBFD_NFYB_HMF 41 105 4.5e-23 PFAM
low complexity region 150 190 N/A INTRINSIC
low complexity region 193 231 N/A INTRINSIC
low complexity region 275 297 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000134979
SMART Domains Protein: ENSMUSP00000114640
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
PDB:1N1J|B 23 58 8e-9 PDB
low complexity region 88 128 N/A INTRINSIC
low complexity region 132 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136236
SMART Domains Protein: ENSMUSP00000117646
Gene: ENSMUSG00000032897

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:CBFD_NFYB_HMF 41 70 5.1e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196073
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one subunit of a trimeric complex forming a highly conserved transcription factor that binds with high specificity to CCAAT motifs in the promoters of a variety of genes. The encoded protein, subunit C, forms a tight dimer with the B subunit, a prerequisite for subunit A association. The resulting trimer binds to DNA with high specificity and affinity. Subunits B and C each contain a histone-like motif. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,433,397 R126C possibly damaging Het
Abcb9 C A 5: 124,078,826 A443S probably benign Het
Adcy3 A G 12: 4,212,171 M1074V probably damaging Het
Adnp A G 2: 168,183,534 Y614H probably damaging Het
Agbl4 G A 4: 111,566,717 M313I possibly damaging Het
AI987944 T C 7: 41,374,919 D212G probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aplp1 A G 7: 30,436,023 S537P probably benign Het
Arap2 T A 5: 62,669,129 R1031* probably null Het
Arid1a A G 4: 133,680,389 M2269T unknown Het
Ash1l C A 3: 88,985,052 P1413T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt5 A T 16: 19,769,867 I279L probably damaging Het
Camkk2 T C 5: 122,734,278 probably null Het
Ccdc158 T C 5: 92,649,044 K478E probably damaging Het
Ces1f T C 8: 93,274,154 I121V probably benign Het
Chad A T 11: 94,565,137 probably benign Het
Col6a1 T C 10: 76,709,918 I907V unknown Het
Cpe T A 8: 64,594,935 T432S probably benign Het
Csmd3 T C 15: 47,731,929 T1941A possibly damaging Het
Dennd3 G A 15: 73,532,846 V257I probably benign Het
Dnajc21 T C 15: 10,459,951 probably null Het
Dqx1 A G 6: 83,059,452 R146G possibly damaging Het
Etf1 T C 18: 34,909,223 E261G probably damaging Het
Fermt2 C T 14: 45,461,787 V617I possibly damaging Het
Gabarap T C 11: 69,991,725 Y5H probably damaging Het
Gdap1 A G 1: 17,145,557 Y29C probably damaging Het
Gimap5 A G 6: 48,753,030 E178G probably damaging Het
Gpatch1 C T 7: 35,303,338 G249E probably damaging Het
Gse1 T G 8: 120,572,394 probably benign Het
Kifc3 T C 8: 95,109,887 D82G probably damaging Het
Kit G A 5: 75,637,317 D422N probably benign Het
Klhl28 A T 12: 64,957,221 F173I probably damaging Het
Klk1b22 A G 7: 44,116,854 D253G possibly damaging Het
Lias T A 5: 65,392,291 H39Q probably benign Het
Lrp1b T A 2: 40,903,389 D2504V probably damaging Het
Mgat5 A T 1: 127,459,979 R557S probably damaging Het
Mrpl54 T C 10: 81,265,655 T91A probably benign Het
Myh3 T A 11: 67,093,545 D1069E possibly damaging Het
Nek1 T A 8: 61,124,326 probably null Het
Nol7 A T 13: 43,398,628 E75V probably damaging Het
Nomo1 T A 7: 46,060,913 V606E probably damaging Het
Npat TGGTAAAA T 9: 53,563,066 probably null Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Ogdh A T 11: 6,347,827 probably null Het
Olfr99 A G 17: 37,279,745 V225A probably benign Het
Parg A T 14: 32,209,628 K402* probably null Het
Patj G A 4: 98,469,582 G695E probably damaging Het
Pde3a G A 6: 141,487,574 S777N probably benign Het
Phactr2 G A 10: 13,253,792 P174L possibly damaging Het
Phtf1 C T 3: 103,987,434 R113* probably null Het
Pik3r4 G T 9: 105,687,244 V1346L probably benign Het
Prkcb T C 7: 122,594,642 W525R probably damaging Het
Prl8a1 C T 13: 27,574,072 R218H possibly damaging Het
Pum3 T C 19: 27,398,910 E536G probably benign Het
Rb1 T C 14: 73,262,602 N535S probably benign Het
Rbm7 G T 9: 48,489,716 D237E probably benign Het
Ripor1 T C 8: 105,615,548 V122A probably damaging Het
Sdhc C T 1: 171,145,801 R11H probably benign Het
Sema3c A G 5: 17,682,031 N360S possibly damaging Het
Serpinb5 T A 1: 106,881,707 M281K probably benign Het
Serpinc1 A G 1: 160,995,319 E210G probably benign Het
Shoc2 T C 19: 53,987,771 S31P probably benign Het
Sult2a3 T A 7: 14,122,911 N28I possibly damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Tacc3 G A 5: 33,664,597 V234I probably benign Het
Tacr1 A T 6: 82,492,530 M132L possibly damaging Het
Tas2r104 C A 6: 131,685,294 V151F probably benign Het
Tbc1d10b C T 7: 127,203,778 S326N probably benign Het
Trim12c C T 7: 104,348,244 C35Y probably damaging Het
Trrap T C 5: 144,818,313 I2067T probably benign Het
Upk1a T C 7: 30,606,886 I152V probably benign Het
Vmn2r39 T G 7: 9,014,956 T794P probably damaging Het
Wnk2 G A 13: 49,057,232 P1704S probably damaging Het
Zfp609 T C 9: 65,703,311 E790G possibly damaging Het
Zmym1 G T 4: 127,048,612 T563K probably damaging Het
Zranb1 T A 7: 132,950,016 F132Y probably benign Het
Zranb3 C T 1: 128,091,862 A48T probably damaging Het
Other mutations in Nfyc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Nfyc APN 4 120781547 intron probably benign
IGL01522:Nfyc APN 4 120781524 missense probably damaging 1.00
IGL01673:Nfyc APN 4 120779110 unclassified probably benign
IGL03197:Nfyc APN 4 120773761 missense probably damaging 1.00
PIT4378001:Nfyc UTSW 4 120790491 critical splice acceptor site probably null
R0638:Nfyc UTSW 4 120768884 missense probably benign 0.19
R0725:Nfyc UTSW 4 120768734 unclassified probably benign
R0842:Nfyc UTSW 4 120759377 missense probably benign 0.16
R1535:Nfyc UTSW 4 120761724 missense probably damaging 0.99
R1940:Nfyc UTSW 4 120773664 splice site probably benign
R3753:Nfyc UTSW 4 120765330 unclassified probably benign
R5605:Nfyc UTSW 4 120790489 splice site probably benign
R6047:Nfyc UTSW 4 120779117 splice site probably null
R7545:Nfyc UTSW 4 120773769 critical splice acceptor site probably null
Z1176:Nfyc UTSW 4 120790487 splice site probably benign
Z1177:Nfyc UTSW 4 120790466 missense unknown
Predicted Primers PCR Primer
(F):5'- TCCAGTCCTGGCATAGACAAGTAGC -3'
(R):5'- AGGCAACTGCACATAGCCTGTTTC -3'

Sequencing Primer
(F):5'- catcttgtccactgcactttc -3'
(R):5'- CACATAGCCTGTTTCAGGGAAG -3'
Posted On2014-03-28