Incidental Mutation 'R1480:Sult2a3'
ID164290
Institutional Source Beutler Lab
Gene Symbol Sult2a3
Ensembl Gene ENSMUSG00000074375
Gene Namesulfotransferase family 2A, dehydroepiandrosterone (DHEA)-preferring, member 3
SynonymsGm6955
MMRRC Submission 039533-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1480 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location14067446-14123044 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14122911 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 28 (N28I)
Ref Sequence ENSEMBL: ENSMUSP00000096407 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098809]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098809
AA Change: N28I

PolyPhen 2 Score 0.508 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096407
Gene: ENSMUSG00000074375
AA Change: N28I

DomainStartEndE-ValueType
Pfam:Sulfotransfer_1 34 278 1.5e-83 PFAM
Pfam:Sulfotransfer_3 35 205 3.4e-11 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: This is one of seven sulfotransferase family 2A genes in a chromosome 7 A1 cluster. [provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,433,397 R126C possibly damaging Het
Abcb9 C A 5: 124,078,826 A443S probably benign Het
Adcy3 A G 12: 4,212,171 M1074V probably damaging Het
Adnp A G 2: 168,183,534 Y614H probably damaging Het
Agbl4 G A 4: 111,566,717 M313I possibly damaging Het
AI987944 T C 7: 41,374,919 D212G probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aplp1 A G 7: 30,436,023 S537P probably benign Het
Arap2 T A 5: 62,669,129 R1031* probably null Het
Arid1a A G 4: 133,680,389 M2269T unknown Het
Ash1l C A 3: 88,985,052 P1413T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt5 A T 16: 19,769,867 I279L probably damaging Het
Camkk2 T C 5: 122,734,278 probably null Het
Ccdc158 T C 5: 92,649,044 K478E probably damaging Het
Ces1f T C 8: 93,274,154 I121V probably benign Het
Chad A T 11: 94,565,137 probably benign Het
Col6a1 T C 10: 76,709,918 I907V unknown Het
Cpe T A 8: 64,594,935 T432S probably benign Het
Csmd3 T C 15: 47,731,929 T1941A possibly damaging Het
Dennd3 G A 15: 73,532,846 V257I probably benign Het
Dnajc21 T C 15: 10,459,951 probably null Het
Dqx1 A G 6: 83,059,452 R146G possibly damaging Het
Etf1 T C 18: 34,909,223 E261G probably damaging Het
Fermt2 C T 14: 45,461,787 V617I possibly damaging Het
Gabarap T C 11: 69,991,725 Y5H probably damaging Het
Gdap1 A G 1: 17,145,557 Y29C probably damaging Het
Gimap5 A G 6: 48,753,030 E178G probably damaging Het
Gpatch1 C T 7: 35,303,338 G249E probably damaging Het
Gse1 T G 8: 120,572,394 probably benign Het
Kifc3 T C 8: 95,109,887 D82G probably damaging Het
Kit G A 5: 75,637,317 D422N probably benign Het
Klhl28 A T 12: 64,957,221 F173I probably damaging Het
Klk1b22 A G 7: 44,116,854 D253G possibly damaging Het
Lias T A 5: 65,392,291 H39Q probably benign Het
Lrp1b T A 2: 40,903,389 D2504V probably damaging Het
Mgat5 A T 1: 127,459,979 R557S probably damaging Het
Mrpl54 T C 10: 81,265,655 T91A probably benign Het
Myh3 T A 11: 67,093,545 D1069E possibly damaging Het
Nek1 T A 8: 61,124,326 probably null Het
Nfyc A C 4: 120,768,724 probably null Het
Nol7 A T 13: 43,398,628 E75V probably damaging Het
Nomo1 T A 7: 46,060,913 V606E probably damaging Het
Npat TGGTAAAA T 9: 53,563,066 probably null Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Ogdh A T 11: 6,347,827 probably null Het
Olfr99 A G 17: 37,279,745 V225A probably benign Het
Parg A T 14: 32,209,628 K402* probably null Het
Patj G A 4: 98,469,582 G695E probably damaging Het
Pde3a G A 6: 141,487,574 S777N probably benign Het
Phactr2 G A 10: 13,253,792 P174L possibly damaging Het
Phtf1 C T 3: 103,987,434 R113* probably null Het
Pik3r4 G T 9: 105,687,244 V1346L probably benign Het
Prkcb T C 7: 122,594,642 W525R probably damaging Het
Prl8a1 C T 13: 27,574,072 R218H possibly damaging Het
Pum3 T C 19: 27,398,910 E536G probably benign Het
Rb1 T C 14: 73,262,602 N535S probably benign Het
Rbm7 G T 9: 48,489,716 D237E probably benign Het
Ripor1 T C 8: 105,615,548 V122A probably damaging Het
Sdhc C T 1: 171,145,801 R11H probably benign Het
Sema3c A G 5: 17,682,031 N360S possibly damaging Het
Serpinb5 T A 1: 106,881,707 M281K probably benign Het
Serpinc1 A G 1: 160,995,319 E210G probably benign Het
Shoc2 T C 19: 53,987,771 S31P probably benign Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Tacc3 G A 5: 33,664,597 V234I probably benign Het
Tacr1 A T 6: 82,492,530 M132L possibly damaging Het
Tas2r104 C A 6: 131,685,294 V151F probably benign Het
Tbc1d10b C T 7: 127,203,778 S326N probably benign Het
Trim12c C T 7: 104,348,244 C35Y probably damaging Het
Trrap T C 5: 144,818,313 I2067T probably benign Het
Upk1a T C 7: 30,606,886 I152V probably benign Het
Vmn2r39 T G 7: 9,014,956 T794P probably damaging Het
Wnk2 G A 13: 49,057,232 P1704S probably damaging Het
Zfp609 T C 9: 65,703,311 E790G possibly damaging Het
Zmym1 G T 4: 127,048,612 T563K probably damaging Het
Zranb1 T A 7: 132,950,016 F132Y probably benign Het
Zranb3 C T 1: 128,091,862 A48T probably damaging Het
Other mutations in Sult2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Sult2a3 APN 7 14122980 missense probably benign 0.03
IGL02353:Sult2a3 APN 7 14121650 nonsense probably null
IGL02360:Sult2a3 APN 7 14121650 nonsense probably null
IGL02806:Sult2a3 APN 7 14122932 missense probably damaging 1.00
IGL03252:Sult2a3 APN 7 14067634 missense probably damaging 1.00
R0029:Sult2a3 UTSW 7 14073074 missense probably benign 0.11
R1491:Sult2a3 UTSW 7 14122942 missense probably benign 0.01
R4078:Sult2a3 UTSW 7 14121737 missense possibly damaging 0.94
R4668:Sult2a3 UTSW 7 14122861 missense probably damaging 1.00
R4928:Sult2a3 UTSW 7 14111557 missense probably benign 0.06
R6311:Sult2a3 UTSW 7 14111557 missense probably benign 0.00
R6749:Sult2a3 UTSW 7 14082704 missense probably benign 0.00
R7030:Sult2a3 UTSW 7 14067568 missense probably damaging 1.00
R7232:Sult2a3 UTSW 7 14082760 missense possibly damaging 0.89
R7394:Sult2a3 UTSW 7 14111524 missense probably benign 0.05
R7617:Sult2a3 UTSW 7 14073056 missense probably benign 0.00
R8029:Sult2a3 UTSW 7 14121628 missense probably damaging 1.00
R8097:Sult2a3 UTSW 7 14082710 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCCATGCCCACAAGTCATTTTACACAT -3'
(R):5'- GTTTGGGGTAATGAACTTGGTCTCACA -3'

Sequencing Primer
(F):5'- GTACTAACCTCCCGTATACATTTCAG -3'
(R):5'- GAACTTGGTCTCACAATTTTTGC -3'
Posted On2014-03-28