Incidental Mutation 'R1480:Col6a1'
ID164316
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Namecollagen, type VI, alpha 1
SynonymsCol6a-1
MMRRC Submission 039533-MU
Accession Numbers

Ncbi RefSeq: NM_009933.4; MGI: 88459

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R1480 (G1)
Quality Score212
Status Not validated
Chromosome10
Chromosomal Location76708792-76726168 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76709918 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 907 (I907V)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
Predicted Effect unknown
Transcript: ENSMUST00000001147
AA Change: I907V
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: I907V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype Strain: 2153356
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,433,397 R126C possibly damaging Het
Abcb9 C A 5: 124,078,826 A443S probably benign Het
Adcy3 A G 12: 4,212,171 M1074V probably damaging Het
Adnp A G 2: 168,183,534 Y614H probably damaging Het
Agbl4 G A 4: 111,566,717 M313I possibly damaging Het
AI987944 T C 7: 41,374,919 D212G probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aplp1 A G 7: 30,436,023 S537P probably benign Het
Arap2 T A 5: 62,669,129 R1031* probably null Het
Arid1a A G 4: 133,680,389 M2269T unknown Het
Ash1l C A 3: 88,985,052 P1413T probably damaging Het
Auh G A 13: 52,835,496 P308L probably benign Het
B3gnt5 A T 16: 19,769,867 I279L probably damaging Het
Camkk2 T C 5: 122,734,278 probably null Het
Ccdc158 T C 5: 92,649,044 K478E probably damaging Het
Ces1f T C 8: 93,274,154 I121V probably benign Het
Chad A T 11: 94,565,137 probably benign Het
Cpe T A 8: 64,594,935 T432S probably benign Het
Csmd3 T C 15: 47,731,929 T1941A possibly damaging Het
Dennd3 G A 15: 73,532,846 V257I probably benign Het
Dnajc21 T C 15: 10,459,951 probably null Het
Dqx1 A G 6: 83,059,452 R146G possibly damaging Het
Etf1 T C 18: 34,909,223 E261G probably damaging Het
Fermt2 C T 14: 45,461,787 V617I possibly damaging Het
Gabarap T C 11: 69,991,725 Y5H probably damaging Het
Gdap1 A G 1: 17,145,557 Y29C probably damaging Het
Gimap5 A G 6: 48,753,030 E178G probably damaging Het
Gpatch1 C T 7: 35,303,338 G249E probably damaging Het
Gse1 T G 8: 120,572,394 probably benign Het
Kifc3 T C 8: 95,109,887 D82G probably damaging Het
Kit G A 5: 75,637,317 D422N probably benign Het
Klhl28 A T 12: 64,957,221 F173I probably damaging Het
Klk1b22 A G 7: 44,116,854 D253G possibly damaging Het
Lias T A 5: 65,392,291 H39Q probably benign Het
Lrp1b T A 2: 40,903,389 D2504V probably damaging Het
Mgat5 A T 1: 127,459,979 R557S probably damaging Het
Mrpl54 T C 10: 81,265,655 T91A probably benign Het
Myh3 T A 11: 67,093,545 D1069E possibly damaging Het
Nek1 T A 8: 61,124,326 probably null Het
Nfyc A C 4: 120,768,724 probably null Het
Nol7 A T 13: 43,398,628 E75V probably damaging Het
Nomo1 T A 7: 46,060,913 V606E probably damaging Het
Npat TGGTAAAA T 9: 53,563,066 probably null Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Ogdh A T 11: 6,347,827 probably null Het
Olfr99 A G 17: 37,279,745 V225A probably benign Het
Parg A T 14: 32,209,628 K402* probably null Het
Patj G A 4: 98,469,582 G695E probably damaging Het
Pde3a G A 6: 141,487,574 S777N probably benign Het
Phactr2 G A 10: 13,253,792 P174L possibly damaging Het
Phtf1 C T 3: 103,987,434 R113* probably null Het
Pik3r4 G T 9: 105,687,244 V1346L probably benign Het
Prkcb T C 7: 122,594,642 W525R probably damaging Het
Prl8a1 C T 13: 27,574,072 R218H possibly damaging Het
Pum3 T C 19: 27,398,910 E536G probably benign Het
Rb1 T C 14: 73,262,602 N535S probably benign Het
Rbm7 G T 9: 48,489,716 D237E probably benign Het
Ripor1 T C 8: 105,615,548 V122A probably damaging Het
Sdhc C T 1: 171,145,801 R11H probably benign Het
Sema3c A G 5: 17,682,031 N360S possibly damaging Het
Serpinb5 T A 1: 106,881,707 M281K probably benign Het
Serpinc1 A G 1: 160,995,319 E210G probably benign Het
Shoc2 T C 19: 53,987,771 S31P probably benign Het
Sult2a3 T A 7: 14,122,911 N28I possibly damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Tacc3 G A 5: 33,664,597 V234I probably benign Het
Tacr1 A T 6: 82,492,530 M132L possibly damaging Het
Tas2r104 C A 6: 131,685,294 V151F probably benign Het
Tbc1d10b C T 7: 127,203,778 S326N probably benign Het
Trim12c C T 7: 104,348,244 C35Y probably damaging Het
Trrap T C 5: 144,818,313 I2067T probably benign Het
Upk1a T C 7: 30,606,886 I152V probably benign Het
Vmn2r39 T G 7: 9,014,956 T794P probably damaging Het
Wnk2 G A 13: 49,057,232 P1704S probably damaging Het
Zfp609 T C 9: 65,703,311 E790G possibly damaging Het
Zmym1 G T 4: 127,048,612 T563K probably damaging Het
Zranb1 T A 7: 132,950,016 F132Y probably benign Het
Zranb3 C T 1: 128,091,862 A48T probably damaging Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76710979 missense unknown
IGL01943:Col6a1 APN 10 76719123 critical splice donor site probably null
IGL02178:Col6a1 APN 10 76711075 missense unknown
IGL02928:Col6a1 APN 10 76709666 missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76718051 splice site probably benign
P0005:Col6a1 UTSW 10 76717329 splice site probably benign
R0398:Col6a1 UTSW 10 76710118 missense unknown
R0631:Col6a1 UTSW 10 76709735 missense probably benign 0.03
R0698:Col6a1 UTSW 10 76716280 missense unknown
R0699:Col6a1 UTSW 10 76716280 missense unknown
R0848:Col6a1 UTSW 10 76713624 critical splice donor site probably null
R1053:Col6a1 UTSW 10 76720966 missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76712324 missense unknown
R1854:Col6a1 UTSW 10 76721949 missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76721956 missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76709596 missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76721498 missense probably benign 0.10
R2411:Col6a1 UTSW 10 76711088 missense unknown
R3236:Col6a1 UTSW 10 76711320 missense unknown
R3417:Col6a1 UTSW 10 76712369 missense unknown
R3832:Col6a1 UTSW 10 76711117 missense unknown
R3843:Col6a1 UTSW 10 76711341 missense unknown
R3903:Col6a1 UTSW 10 76711341 missense unknown
R3904:Col6a1 UTSW 10 76711341 missense unknown
R4409:Col6a1 UTSW 10 76721500 missense probably benign 0.17
R4418:Col6a1 UTSW 10 76718405 nonsense probably null
R4568:Col6a1 UTSW 10 76719197 intron probably benign
R4579:Col6a1 UTSW 10 76711357 missense unknown
R4661:Col6a1 UTSW 10 76714672 missense unknown
R4945:Col6a1 UTSW 10 76712272 missense unknown
R4958:Col6a1 UTSW 10 76723505 missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76709906 missense unknown
R5440:Col6a1 UTSW 10 76723454 missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76718371 critical splice donor site probably null
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6030:Col6a1 UTSW 10 76709866 missense unknown
R6366:Col6a1 UTSW 10 76710970 missense unknown
R6435:Col6a1 UTSW 10 76711123 missense unknown
R6718:Col6a1 UTSW 10 76725050 missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76721443 missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76725009 missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76710341 splice site probably null
R7183:Col6a1 UTSW 10 76716259 critical splice donor site probably null
R7244:Col6a1 UTSW 10 76717408 nonsense probably null
R7625:Col6a1 UTSW 10 76713926 missense unknown
R7741:Col6a1 UTSW 10 76709909 missense unknown
R7774:Col6a1 UTSW 10 76709876 missense unknown
R7834:Col6a1 UTSW 10 76709928 missense unknown
R8145:Col6a1 UTSW 10 76723471 missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76725029 missense probably damaging 1.00
RF019:Col6a1 UTSW 10 76711615 missense unknown
X0010:Col6a1 UTSW 10 76723538 missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76709975 missense unknown
Z1088:Col6a1 UTSW 10 76709559 makesense probably null
Predicted Primers PCR Primer
(F):5'- AGATCTCAATGCCTGCACGCTG -3'
(R):5'- GCTGACATCACCATCCTGCTAGAC -3'

Sequencing Primer
(F):5'- CTGGGCCTCCTGCACAG -3'
(R):5'- TGCTAGACAGCTCAGCCAG -3'
Posted On2014-03-28