Incidental Mutation 'R1480:Auh'
ID164330
Institutional Source Beutler Lab
Gene Symbol Auh
Ensembl Gene ENSMUSG00000021460
Gene NameAU RNA binding protein/enoyl-coenzyme A hydratase
SynonymsW91705
MMRRC Submission 039533-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1480 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location52835119-52929681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 52835496 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 308 (P308L)
Ref Sequence ENSEMBL: ENSMUSP00000021913 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021913]
Predicted Effect probably benign
Transcript: ENSMUST00000021913
AA Change: P308L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021913
Gene: ENSMUSG00000021460
AA Change: P308L

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ECH_1 59 314 4.5e-62 PFAM
Pfam:ECH_2 64 248 1.6e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137064
SMART Domains Protein: ENSMUSP00000121852
Gene: ENSMUSG00000021460

DomainStartEndE-ValueType
Pfam:ECH_2 1 179 1.9e-28 PFAM
Pfam:ECH_1 1 236 1.1e-51 PFAM
Meta Mutation Damage Score 0.0797 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes bifunctional mitochondrial protein that has both RNA-binding and hydratase activities. The encoded protein is a methylglutaconyl-CoA hydratase that catalyzes the hydration of 3-methylglutaconyl-CoA to 3-hydroxy-3-methyl-glutaryl-CoA, a critical step in the leucine degradation pathway. This protein also binds AU-rich elements (AREs) found in the 3' UTRs of rapidly decaying mRNAs including c-fos, c-myc and granulocyte/ macrophage colony stimulating factor. ARE elements are involved in directing RNA to rapid degradation and deadenylation. This protein is localizes to the mitochondrial matrix and the inner mitochondrial membrane and may be involved in mitochondrial protein synthesis. Mutations in this gene are the cause of 3-methylglutaconic aciduria, type I. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 C T 2: 25,433,397 R126C possibly damaging Het
Abcb9 C A 5: 124,078,826 A443S probably benign Het
Adcy3 A G 12: 4,212,171 M1074V probably damaging Het
Adnp A G 2: 168,183,534 Y614H probably damaging Het
Agbl4 G A 4: 111,566,717 M313I possibly damaging Het
AI987944 T C 7: 41,374,919 D212G probably benign Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aplp1 A G 7: 30,436,023 S537P probably benign Het
Arap2 T A 5: 62,669,129 R1031* probably null Het
Arid1a A G 4: 133,680,389 M2269T unknown Het
Ash1l C A 3: 88,985,052 P1413T probably damaging Het
B3gnt5 A T 16: 19,769,867 I279L probably damaging Het
Camkk2 T C 5: 122,734,278 probably null Het
Ccdc158 T C 5: 92,649,044 K478E probably damaging Het
Ces1f T C 8: 93,274,154 I121V probably benign Het
Chad A T 11: 94,565,137 probably benign Het
Col6a1 T C 10: 76,709,918 I907V unknown Het
Cpe T A 8: 64,594,935 T432S probably benign Het
Csmd3 T C 15: 47,731,929 T1941A possibly damaging Het
Dennd3 G A 15: 73,532,846 V257I probably benign Het
Dnajc21 T C 15: 10,459,951 probably null Het
Dqx1 A G 6: 83,059,452 R146G possibly damaging Het
Etf1 T C 18: 34,909,223 E261G probably damaging Het
Fermt2 C T 14: 45,461,787 V617I possibly damaging Het
Gabarap T C 11: 69,991,725 Y5H probably damaging Het
Gdap1 A G 1: 17,145,557 Y29C probably damaging Het
Gimap5 A G 6: 48,753,030 E178G probably damaging Het
Gpatch1 C T 7: 35,303,338 G249E probably damaging Het
Gse1 T G 8: 120,572,394 probably benign Het
Kifc3 T C 8: 95,109,887 D82G probably damaging Het
Kit G A 5: 75,637,317 D422N probably benign Het
Klhl28 A T 12: 64,957,221 F173I probably damaging Het
Klk1b22 A G 7: 44,116,854 D253G possibly damaging Het
Lias T A 5: 65,392,291 H39Q probably benign Het
Lrp1b T A 2: 40,903,389 D2504V probably damaging Het
Mgat5 A T 1: 127,459,979 R557S probably damaging Het
Mrpl54 T C 10: 81,265,655 T91A probably benign Het
Myh3 T A 11: 67,093,545 D1069E possibly damaging Het
Nek1 T A 8: 61,124,326 probably null Het
Nfyc A C 4: 120,768,724 probably null Het
Nol7 A T 13: 43,398,628 E75V probably damaging Het
Nomo1 T A 7: 46,060,913 V606E probably damaging Het
Npat TGGTAAAA T 9: 53,563,066 probably null Het
Nt5c1b A G 12: 10,374,886 E142G probably damaging Het
Ogdh A T 11: 6,347,827 probably null Het
Olfr99 A G 17: 37,279,745 V225A probably benign Het
Parg A T 14: 32,209,628 K402* probably null Het
Patj G A 4: 98,469,582 G695E probably damaging Het
Pde3a G A 6: 141,487,574 S777N probably benign Het
Phactr2 G A 10: 13,253,792 P174L possibly damaging Het
Phtf1 C T 3: 103,987,434 R113* probably null Het
Pik3r4 G T 9: 105,687,244 V1346L probably benign Het
Prkcb T C 7: 122,594,642 W525R probably damaging Het
Prl8a1 C T 13: 27,574,072 R218H possibly damaging Het
Pum3 T C 19: 27,398,910 E536G probably benign Het
Rb1 T C 14: 73,262,602 N535S probably benign Het
Rbm7 G T 9: 48,489,716 D237E probably benign Het
Ripor1 T C 8: 105,615,548 V122A probably damaging Het
Sdhc C T 1: 171,145,801 R11H probably benign Het
Sema3c A G 5: 17,682,031 N360S possibly damaging Het
Serpinb5 T A 1: 106,881,707 M281K probably benign Het
Serpinc1 A G 1: 160,995,319 E210G probably benign Het
Shoc2 T C 19: 53,987,771 S31P probably benign Het
Sult2a3 T A 7: 14,122,911 N28I possibly damaging Het
Svil C T 18: 5,057,345 P598S probably damaging Het
Tacc3 G A 5: 33,664,597 V234I probably benign Het
Tacr1 A T 6: 82,492,530 M132L possibly damaging Het
Tas2r104 C A 6: 131,685,294 V151F probably benign Het
Tbc1d10b C T 7: 127,203,778 S326N probably benign Het
Trim12c C T 7: 104,348,244 C35Y probably damaging Het
Trrap T C 5: 144,818,313 I2067T probably benign Het
Upk1a T C 7: 30,606,886 I152V probably benign Het
Vmn2r39 T G 7: 9,014,956 T794P probably damaging Het
Wnk2 G A 13: 49,057,232 P1704S probably damaging Het
Zfp609 T C 9: 65,703,311 E790G possibly damaging Het
Zmym1 G T 4: 127,048,612 T563K probably damaging Het
Zranb1 T A 7: 132,950,016 F132Y probably benign Het
Zranb3 C T 1: 128,091,862 A48T probably damaging Het
Other mutations in Auh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Auh APN 13 52838102 missense probably damaging 1.00
IGL02108:Auh APN 13 52889097 splice site probably benign
IGL02613:Auh APN 13 52918999 critical splice donor site probably null
PIT4131001:Auh UTSW 13 52841010 missense probably damaging 1.00
R0046:Auh UTSW 13 52929385 splice site probably benign
R0741:Auh UTSW 13 52929602 missense possibly damaging 0.53
R1515:Auh UTSW 13 52835496 missense probably benign 0.00
R1581:Auh UTSW 13 52835496 missense probably benign 0.00
R1609:Auh UTSW 13 52835496 missense probably benign 0.00
R1611:Auh UTSW 13 52835496 missense probably benign 0.00
R1723:Auh UTSW 13 52835496 missense probably benign 0.00
R1724:Auh UTSW 13 52835496 missense probably benign 0.00
R1725:Auh UTSW 13 52835496 missense probably benign 0.00
R1742:Auh UTSW 13 52835496 missense probably benign 0.00
R1883:Auh UTSW 13 52835496 missense probably benign 0.00
R1884:Auh UTSW 13 52835496 missense probably benign 0.00
R1919:Auh UTSW 13 52835496 missense probably benign 0.00
R2022:Auh UTSW 13 52835496 missense probably benign 0.00
R2071:Auh UTSW 13 52835496 missense probably benign 0.00
R2114:Auh UTSW 13 52835496 missense probably benign 0.00
R2147:Auh UTSW 13 52835496 missense probably benign 0.00
R2149:Auh UTSW 13 52835496 missense probably benign 0.00
R2429:Auh UTSW 13 52919016 missense probably damaging 1.00
R2508:Auh UTSW 13 52898719 nonsense probably null
R2960:Auh UTSW 13 52839574 missense probably damaging 1.00
R3787:Auh UTSW 13 52929457 missense possibly damaging 0.95
R4594:Auh UTSW 13 52912966 unclassified probably benign
R4989:Auh UTSW 13 52841029 missense probably damaging 1.00
R5863:Auh UTSW 13 52898658 missense probably benign 0.06
R6041:Auh UTSW 13 52919086 missense possibly damaging 0.71
R6425:Auh UTSW 13 52841044 missense probably damaging 1.00
R6430:Auh UTSW 13 52929410 missense probably benign 0.41
R6434:Auh UTSW 13 52929410 missense probably benign 0.41
R6664:Auh UTSW 13 52898667 missense probably damaging 0.99
R6865:Auh UTSW 13 52838129 missense probably damaging 1.00
R7615:Auh UTSW 13 52919013 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAGACGCGGATTCTCAAATCAC -3'
(R):5'- TTGTTCAAAGGACTCTCGGCCTTC -3'

Sequencing Primer
(F):5'- tgtgtgtgtgtgtgtttgtg -3'
(R):5'- CTCGGCCTTCCCAGCAG -3'
Posted On2014-03-28