Mutagenetix > Incidental Mutations

Incidental Mutation 'R1481:Cps1'

164343

Institutional Source

Beutler Lab

Gene Symbol

Cps1

Ensembl Gene

ENSMUSG00000025991

Gene Name

carbamoyl-phosphate synthetase 1

Synonyms

CPSase I, D1Ucla3, CPS, 4732433M03Rik

MMRRC Submission

039534-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1481 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

67123026-67231259 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 67143882 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 133 (V133A)

Ref Sequence

ENSEMBL: ENSMUSP00000027144 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027144]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027144
AA Change: V133A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000027144
Gene: ENSMUSG00000025991
AA Change: V133A

Domain	Start	End	E-Value	Type
CPSase_sm_chain	44	184	2.5e-70	SMART
Pfam:GATase	221	397	1.5e-40	PFAM
low complexity region	426	436	N/A	INTRINSIC
Pfam:ATP-grasp_4	543	724	6.8e-12	PFAM
Pfam:CPSase_L_D2	546	750	1.7e-85	PFAM
Pfam:ATP-grasp	554	722	4.9e-8	PFAM
Pfam:Dala_Dala_lig_C	561	718	1.5e-7	PFAM
CPSase_L_D3	839	962	1.18e-57	SMART
Pfam:ATP-grasp_4	1085	1264	1e-19	PFAM
Pfam:CPSase_L_D2	1088	1291	7.4e-32	PFAM
Pfam:Dala_Dala_lig_C	1095	1279	1.6e-6	PFAM
Pfam:ATP-grasp	1096	1263	2.8e-12	PFAM
MGS	1373	1465	1.53e-15	SMART

Meta Mutation Damage Score

0.8162

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: This gene encodes a protein localized to the inner mitochondrial matrix. The encoded protein plays a role in the detoxification of ammonia by catalyzing the first step in the urea cycle in which carbomyl-phosphate is synthesized from ammonia and bicarbonate. Carbamoyl-phosphate is subsequently converted to urea that is excreted by the kidneys. Deficiency of the encoded enzyme leads to an accumulation of ammonia in the blood. High levels of ammonia are toxic to the central nervous system and result in neurological disorders. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygous mutation of this gene results in death by 36 hours after birth and hyperammonemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 37,008,434	V3365A	probably damaging	Het
Arhgef5	A	G	6: 43,274,634	H773R	probably damaging	Het
Bmp3	G	A	5: 98,872,470	V251M	probably damaging	Het
Ccdc175	C	A	12: 72,101,948		probably benign	Het
Ccdc178	C	T	18: 22,105,621	G313D	probably benign	Het
Cd300ld2	T	A	11: 115,012,633	I129F	probably benign	Het
Cep170	T	C	1: 176,782,385	Q120R	possibly damaging	Het
Ckb	T	C	12: 111,671,262	H145R	probably benign	Het
Cntnap5a	T	A	1: 116,117,663	N336K	probably damaging	Het
Coil	T	A	11: 88,974,060	C38S	possibly damaging	Het
Cspg4	A	G	9: 56,887,810	E943G	probably damaging	Het
Cyp2c54	C	T	19: 40,047,588	D293N	probably benign	Het
Cyp2f2	T	C	7: 27,121,877	S72P	probably benign	Het
Dip2c	G	A	13: 9,551,866		probably null	Het
Dock6	T	C	9: 21,820,622	T1158A	probably benign	Het
Dscaml1	G	A	9: 45,672,643	V469I	probably benign	Het
Efcab14	A	G	4: 115,756,517	T221A	probably benign	Het
Ehbp1	T	C	11: 22,006,782	*1207W	probably null	Het
Eln	T	C	5: 134,706,572	K786E	probably damaging	Het
Fyb	C	T	15: 6,619,647	P385S	probably benign	Het
Galr1	A	G	18: 82,405,741	I137T	possibly damaging	Het
Gcm1	A	T	9: 78,059,717	K73*	probably null	Het
Gemin5	T	C	11: 58,141,654	N775D	probably damaging	Het
Gli3	C	T	13: 15,613,850	H147Y	probably damaging	Het
Gm10754	G	T	10: 97,682,227		probably benign	Het
Gpr37	T	C	6: 25,669,138	D569G	probably damaging	Het
Grina	T	A	15: 76,249,089	Y286N	probably damaging	Het
Gtf3c1	C	A	7: 125,693,138		probably null	Het
Kcnc4	C	T	3: 107,448,218	V305M	probably benign	Het
Kntc1	T	C	5: 123,778,275	F724L	probably benign	Het
Kpnb1	T	C	11: 97,178,310	Y249C	probably damaging	Het
Krt6b	T	C	15: 101,678,374	T269A	probably benign	Het
Lamc1	T	C	1: 153,221,634	K1555E	probably damaging	Het
Maneal	T	C	4: 124,861,857	Y104C	probably damaging	Het
Map1b	T	C	13: 99,431,171	T1681A	unknown	Het
Mettl17	T	C	14: 51,890,703	L272P	probably benign	Het
Mib2	T	A	4: 155,656,999	S357C	probably benign	Het
Mmp19	C	A	10: 128,798,178	T316K	possibly damaging	Het
Mroh9	C	T	1: 163,026,509	G774E	probably damaging	Het
Myh1	T	C	11: 67,205,499		probably benign	Het
Ncor2	C	A	5: 125,027,138	E963*	probably null	Het
Nol6	T	A	4: 41,123,596	T51S	probably benign	Het
Nsun3	A	T	16: 62,735,369	C265S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Nutm2	T	A	13: 50,469,481	N71K	probably damaging	Het
Olfr498	C	T	7: 108,465,960	T212I	probably benign	Het
Olfr713	T	G	7: 107,036,149	L5R	probably benign	Het
Orc3	T	A	4: 34,607,228	E34V	possibly damaging	Het
Pcdhb13	T	A	18: 37,442,836	L89Q	probably damaging	Het
Polr3a	A	T	14: 24,452,548	V1241E	probably null	Het
Prpf39	C	T	12: 65,053,314	P135S	probably damaging	Het
Psrc1	T	C	3: 108,384,993	V34A	probably benign	Het
Rab27a	G	A	9: 73,082,402	V52M	probably benign	Het
Rassf9	A	G	10: 102,546,034	T424A	probably benign	Het
Ripor3	G	T	2: 168,000,377	R61S	possibly damaging	Het
Ryr3	C	T	2: 112,636,522		probably benign	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Setbp1	C	T	18: 78,783,301	V1366M	probably benign	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Tctn2	T	C	5: 124,607,763		noncoding transcript	Het
Tmem45a	A	T	16: 56,811,602	F218I	possibly damaging	Het
Tpte	A	T	8: 22,355,471	R512S	probably damaging	Het
Trim37	T	A	11: 87,129,759	L22*	probably null	Het
Ttc6	A	G	12: 57,737,130	N1792D	probably damaging	Het
Ttn	A	G	2: 76,945,616	M1694T	probably damaging	Het
Vmn1r181	T	A	7: 23,984,712	W201R	probably damaging	Het
Wdr74	C	T	19: 8,738,228	L198F	possibly damaging	Het
Zfp560	T	C	9: 20,348,790	T259A	probably benign	Het

Other mutations in Cps1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00757:Cps1	APN	1	67152380	splice site	probably benign
IGL00897:Cps1	APN	1	67215564	missense	probably benign	0.08
IGL00928:Cps1	APN	1	67123234	missense	probably benign
IGL01063:Cps1	APN	1	67195166	missense	possibly damaging	0.91
IGL01081:Cps1	APN	1	67206824	missense	probably damaging	1.00
IGL01361:Cps1	APN	1	67195145	missense	probably benign	0.03
IGL01396:Cps1	APN	1	67157786	missense	probably damaging	1.00
IGL01516:Cps1	APN	1	67230284	missense	probably damaging	0.99
IGL01695:Cps1	APN	1	67197035	missense	probably benign
IGL02022:Cps1	APN	1	67172872	splice site	probably benign
IGL02032:Cps1	APN	1	67230315	missense	probably benign	0.03
IGL02049:Cps1	APN	1	67143954	missense	possibly damaging	0.68
IGL02197:Cps1	APN	1	67157764	missense	probably benign
IGL02217:Cps1	APN	1	67174382	missense	probably benign	0.06
IGL02555:Cps1	APN	1	67214021	missense	probably benign	0.06
IGL02570:Cps1	APN	1	67148703	splice site	probably benign
IGL02633:Cps1	APN	1	67123237	missense	probably benign
IGL02711:Cps1	APN	1	67212517	splice site	probably benign
IGL02737:Cps1	APN	1	67148774	missense	probably benign	0.35
IGL03030:Cps1	APN	1	67142921	missense	probably damaging	1.00
IGL03255:Cps1	APN	1	67145801	nonsense	probably null
Madman	UTSW	1	67160871	missense	probably damaging	0.96
maniac	UTSW	1	67157878	critical splice donor site	probably null
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0109:Cps1	UTSW	1	67229418	missense	possibly damaging	0.82
R0140:Cps1	UTSW	1	67180116	missense	probably benign
R0318:Cps1	UTSW	1	67177014	missense	probably damaging	0.99
R0486:Cps1	UTSW	1	67165392	missense	probably damaging	1.00
R0488:Cps1	UTSW	1	67148808	splice site	probably benign
R0492:Cps1	UTSW	1	67157836	missense	probably damaging	1.00
R0521:Cps1	UTSW	1	67215564	missense	probably benign	0.02
R0534:Cps1	UTSW	1	67143900	missense	probably benign	0.06
R0565:Cps1	UTSW	1	67166449	missense	possibly damaging	0.57
R0609:Cps1	UTSW	1	67172802	missense	probably damaging	1.00
R0612:Cps1	UTSW	1	67139770	missense	probably benign	0.01
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1185:Cps1	UTSW	1	67195199	missense	probably benign	0.00
R1220:Cps1	UTSW	1	67204703	critical splice donor site	probably null
R1321:Cps1	UTSW	1	67143019	splice site	probably benign
R1343:Cps1	UTSW	1	67209609	missense	probably damaging	1.00
R1373:Cps1	UTSW	1	67229424	missense	possibly damaging	0.89
R1374:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1711:Cps1	UTSW	1	67168374	splice site	probably null
R1712:Cps1	UTSW	1	67230281	missense	probably damaging	0.97
R1774:Cps1	UTSW	1	67170882	missense	possibly damaging	0.94
R1799:Cps1	UTSW	1	67209642	missense	probably damaging	1.00
R1954:Cps1	UTSW	1	67195196	missense	possibly damaging	0.71
R2074:Cps1	UTSW	1	67204638	missense	probably benign	0.21
R2078:Cps1	UTSW	1	67157806	missense	probably damaging	1.00
R2078:Cps1	UTSW	1	67195265	missense	possibly damaging	0.74
R2111:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2112:Cps1	UTSW	1	67176980	missense	probably benign	0.01
R2146:Cps1	UTSW	1	67152379	splice site	probably benign
R2355:Cps1	UTSW	1	67156224	missense	probably damaging	1.00
R2375:Cps1	UTSW	1	67217860	missense	probably benign	0.00
R2860:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2861:Cps1	UTSW	1	67166375	missense	probably benign	0.44
R2979:Cps1	UTSW	1	67204704	critical splice donor site	probably null
R3427:Cps1	UTSW	1	67174494	missense	probably damaging	1.00
R3833:Cps1	UTSW	1	67139787	missense	probably damaging	1.00
R3857:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3858:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3859:Cps1	UTSW	1	67168278	missense	probably damaging	1.00
R3886:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3887:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3888:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R3889:Cps1	UTSW	1	67165500	missense	possibly damaging	0.83
R4386:Cps1	UTSW	1	67170995	critical splice donor site	probably null
R4497:Cps1	UTSW	1	67205199	missense	probably null	1.00
R4671:Cps1	UTSW	1	67196560	missense	probably damaging	1.00
R4774:Cps1	UTSW	1	67220512	missense	probably damaging	0.99
R4799:Cps1	UTSW	1	67142986	missense	probably damaging	0.96
R4853:Cps1	UTSW	1	67156202	missense	possibly damaging	0.51
R4884:Cps1	UTSW	1	67177024	missense	probably benign	0.11
R4900:Cps1	UTSW	1	67160904	missense	probably damaging	1.00
R4906:Cps1	UTSW	1	67139763	missense	probably benign	0.10
R5091:Cps1	UTSW	1	67229520	critical splice donor site	probably null
R5102:Cps1	UTSW	1	67206793	missense	probably benign	0.00
R5215:Cps1	UTSW	1	67166380	missense	possibly damaging	0.62
R5290:Cps1	UTSW	1	67172709	missense	probably benign	0.21
R5732:Cps1	UTSW	1	67157764	missense	probably benign	0.22
R5818:Cps1	UTSW	1	67166488	missense	possibly damaging	0.96
R5878:Cps1	UTSW	1	67157878	critical splice donor site	probably null
R6002:Cps1	UTSW	1	67172755	missense	possibly damaging	0.94
R6034:Cps1	UTSW	1	67157713	splice site	probably null
R6034:Cps1	UTSW	1	67157713	splice site	probably null
R6199:Cps1	UTSW	1	67162615	frame shift	probably null
R6310:Cps1	UTSW	1	67142981	missense	probably benign	0.00
R6554:Cps1	UTSW	1	67174469	nonsense	probably null
R6700:Cps1	UTSW	1	67229523	splice site	probably null
R6731:Cps1	UTSW	1	67160871	missense	probably damaging	0.96
R7052:Cps1	UTSW	1	67198410	missense	probably damaging	1.00
R7278:Cps1	UTSW	1	67170921	missense	probably damaging	1.00
R7313:Cps1	UTSW	1	67198358	missense	probably damaging	0.99
R7323:Cps1	UTSW	1	67157869	missense	probably benign	0.03
R7339:Cps1	UTSW	1	67197015	missense	possibly damaging	0.64
R7485:Cps1	UTSW	1	67139857	missense	probably damaging	1.00
R7505:Cps1	UTSW	1	67180081	missense	probably benign
R7748:Cps1	UTSW	1	67139806	missense	probably damaging	1.00
R7853:Cps1	UTSW	1	67174481	missense	possibly damaging	0.92
R8097:Cps1	UTSW	1	67228270	missense	probably benign	0.08
R8357:Cps1	UTSW	1	67156854	missense	probably damaging	1.00
R8435:Cps1	UTSW	1	67212430	missense	probably benign	0.07
R8457:Cps1	UTSW	1	67156854	missense	probably damaging	1.00
R8680:Cps1	UTSW	1	67204613	missense	probably damaging	1.00
R8805:Cps1	UTSW	1	67176951	missense	not run
R8811:Cps1	UTSW	1	67214087	missense	not run
R8819:Cps1	UTSW	1	67228280	missense	not run
R8820:Cps1	UTSW	1	67228280	missense	not run
X0024:Cps1	UTSW	1	67123247	missense	probably benign
Z1176:Cps1	UTSW	1	67123268	missense	possibly damaging	0.54
Z1176:Cps1	UTSW	1	67148719	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTGCAAGGCAAACTCACTTTC -3'
(R):5'- GACTATGTGCCCTACACACAGAGC -3'

Sequencing Primer
(F):5'- CTCACTTTCCAAAAGTAGCATTAAGG -3'
(R):5'- GCGCCATCTAGTGGATAAACTG -3'

Posted On

2014-03-28