Incidental Mutation 'R1481:Kcnc4'
ID 164354
Institutional Source Beutler Lab
Gene Symbol Kcnc4
Ensembl Gene ENSMUSG00000027895
Gene Name potassium voltage gated channel, Shaw-related subfamily, member 4
Synonyms Kcr2-4, Kv3.4
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 107438303-107459552 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 107448218 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 305 (V305M)
Ref Sequence ENSEMBL: ENSMUSP00000009617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009617]
AlphaFold Q8R1C0
Predicted Effect probably benign
Transcript: ENSMUST00000009617
AA Change: V305M

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000009617
Gene: ENSMUSG00000027895
AA Change: V305M

DomainStartEndE-ValueType
Pfam:Potassium_chann 1 29 3e-23 PFAM
BTB 36 155 4.66e-16 SMART
low complexity region 168 185 N/A INTRINSIC
low complexity region 194 211 N/A INTRINSIC
Pfam:Ion_trans 229 487 2.6e-46 PFAM
Pfam:Ion_trans_2 386 480 3e-12 PFAM
low complexity region 489 505 N/A INTRINSIC
Meta Mutation Damage Score 0.4520 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Shaker gene family of Drosophila encodes components of voltage-gated potassium channels and is comprised of four subfamilies. Based on sequence similarity, this gene is similar to the Shaw subfamily. The protein encoded by this gene belongs to the delayed rectifier class of channel proteins and is an integral membrane protein that mediates the voltage-dependent potassium ion permeability of excitable membranes. It generates atypical voltage-dependent transient current that may be important for neuronal excitability. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Kcnc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Kcnc4 APN 3 107447873 missense probably benign 0.01
IGL00899:Kcnc4 APN 3 107458463 missense possibly damaging 0.94
IGL01755:Kcnc4 APN 3 107448175 missense probably damaging 1.00
IGL01895:Kcnc4 APN 3 107448218 missense probably benign 0.01
IGL02741:Kcnc4 APN 3 107447978 missense probably damaging 0.98
IGL03393:Kcnc4 APN 3 107447927 missense possibly damaging 0.75
PIT4151001:Kcnc4 UTSW 3 107458703 missense probably damaging 1.00
PIT4378001:Kcnc4 UTSW 3 107447563 missense probably benign
R0158:Kcnc4 UTSW 3 107458604 missense probably benign 0.21
R0415:Kcnc4 UTSW 3 107445433 missense probably damaging 1.00
R0704:Kcnc4 UTSW 3 107447963 missense possibly damaging 0.92
R0747:Kcnc4 UTSW 3 107448154 missense probably damaging 1.00
R1540:Kcnc4 UTSW 3 107445427 splice site probably null
R1602:Kcnc4 UTSW 3 107448204 missense possibly damaging 0.96
R2422:Kcnc4 UTSW 3 107445547 missense probably benign 0.30
R3750:Kcnc4 UTSW 3 107448190 missense probably benign 0.36
R4791:Kcnc4 UTSW 3 107447543 missense probably benign 0.32
R4815:Kcnc4 UTSW 3 107458266 missense probably benign 0.37
R5216:Kcnc4 UTSW 3 107439441 missense probably benign
R5259:Kcnc4 UTSW 3 107448085 missense probably damaging 1.00
R5317:Kcnc4 UTSW 3 107458739 missense probably damaging 0.98
R5474:Kcnc4 UTSW 3 107447891 missense possibly damaging 0.82
R5783:Kcnc4 UTSW 3 107447872 missense possibly damaging 0.69
R5865:Kcnc4 UTSW 3 107458199 critical splice donor site probably null
R6228:Kcnc4 UTSW 3 107448377 missense probably damaging 0.99
R6536:Kcnc4 UTSW 3 107448196 missense possibly damaging 0.81
R7018:Kcnc4 UTSW 3 107458862 missense probably benign 0.00
R7319:Kcnc4 UTSW 3 107458784 missense probably benign 0.21
R7687:Kcnc4 UTSW 3 107458609 small insertion probably benign
R8436:Kcnc4 UTSW 3 107458768 missense probably damaging 0.96
R8707:Kcnc4 UTSW 3 107448133 missense possibly damaging 0.76
R8844:Kcnc4 UTSW 3 107448080 missense probably damaging 1.00
R8868:Kcnc4 UTSW 3 107448136 missense probably damaging 1.00
R9542:Kcnc4 UTSW 3 107458255 nonsense probably null
X0020:Kcnc4 UTSW 3 107447651 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCGTACAAAGCGTACCACACG -3'
(R):5'- GCCAGTTATCACTGACTTGACAGCC -3'

Sequencing Primer
(F):5'- GCAGGAAACCCAGCACATC -3'
(R):5'- CCTACAGGTGGTAGCCTTTGC -3'
Posted On 2014-03-28