Incidental Mutation 'R1481:Orc3'
ID 164356
Institutional Source Beutler Lab
Gene Symbol Orc3
Ensembl Gene ENSMUSG00000040044
Gene Name origin recognition complex, subunit 3
Synonyms Orc3l
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 34570796-34614944 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 34607228 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 34 (E34V)
Ref Sequence ENSEMBL: ENSMUSP00000103777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048706] [ENSMUST00000108142] [ENSMUST00000140334]
AlphaFold Q9JK30
Predicted Effect possibly damaging
Transcript: ENSMUST00000048706
AA Change: E34V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000048319
Gene: ENSMUSG00000040044
AA Change: E34V

DomainStartEndE-ValueType
Pfam:ORC3_N 25 350 3e-130 PFAM
low complexity region 653 664 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000108142
AA Change: E34V

PolyPhen 2 Score 0.504 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000103777
Gene: ENSMUSG00000040044
AA Change: E34V

DomainStartEndE-ValueType
Pfam:ORC3_N 24 350 7.7e-136 PFAM
low complexity region 652 663 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125218
Predicted Effect probably benign
Transcript: ENSMUST00000140334
SMART Domains Protein: ENSMUSP00000119335
Gene: ENSMUSG00000040044

DomainStartEndE-ValueType
Pfam:ORC3_N 2 278 1.4e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156987
Meta Mutation Damage Score 0.1917 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. Studies of a similar gene in Drosophila suggested a possible role of this protein in neuronal proliferation and olfactory memory. Alternatively spliced transcript variants encoding distinct isoforms have been reported for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a conditional allele activated in the neural cells exhibit reduced neuronal precursor proliferation and reduced radial glial cell. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Orc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Orc3 APN 4 34595096 missense probably damaging 1.00
IGL03293:Orc3 APN 4 34595210 missense probably damaging 0.96
IGL02991:Orc3 UTSW 4 34593083 missense probably damaging 1.00
R0157:Orc3 UTSW 4 34607130 critical splice donor site probably null
R0708:Orc3 UTSW 4 34597368 missense probably damaging 1.00
R1331:Orc3 UTSW 4 34599748 missense probably benign 0.01
R1755:Orc3 UTSW 4 34575114 missense possibly damaging 0.67
R1886:Orc3 UTSW 4 34584829 missense probably damaging 1.00
R2008:Orc3 UTSW 4 34611049 splice site probably null
R2054:Orc3 UTSW 4 34584846 missense probably damaging 0.97
R2307:Orc3 UTSW 4 34586503 missense probably damaging 1.00
R3001:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3002:Orc3 UTSW 4 34571790 missense probably benign 0.10
R3153:Orc3 UTSW 4 34575124 missense probably damaging 0.99
R4044:Orc3 UTSW 4 34587055 nonsense probably null
R4814:Orc3 UTSW 4 34572450 splice site probably benign
R4825:Orc3 UTSW 4 34571774 missense possibly damaging 0.95
R4939:Orc3 UTSW 4 34593126 nonsense probably null
R6314:Orc3 UTSW 4 34579797 missense possibly damaging 0.85
R6867:Orc3 UTSW 4 34605539 missense probably damaging 1.00
R7227:Orc3 UTSW 4 34572542 missense probably benign 0.00
R7417:Orc3 UTSW 4 34595136 missense probably damaging 1.00
R7655:Orc3 UTSW 4 34587032 nonsense probably null
R7656:Orc3 UTSW 4 34587032 nonsense probably null
R7707:Orc3 UTSW 4 34598691 nonsense probably null
R7856:Orc3 UTSW 4 34585647 missense probably benign
R7967:Orc3 UTSW 4 34598645 missense probably damaging 0.98
R8058:Orc3 UTSW 4 34595223 nonsense probably null
R8443:Orc3 UTSW 4 34593173 missense probably damaging 1.00
R8670:Orc3 UTSW 4 34572529 missense probably damaging 1.00
R8738:Orc3 UTSW 4 34599778 missense possibly damaging 0.91
R8827:Orc3 UTSW 4 34605569 missense probably benign 0.01
R9303:Orc3 UTSW 4 34607181 nonsense probably null
R9305:Orc3 UTSW 4 34607181 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGCGACGAAGGCCATACATA -3'
(R):5'- TTGAACTGAAAGTCAGCAAGTCAATGC -3'

Sequencing Primer
(F):5'- GACGAAGGCCATACATAACTTTAG -3'
(R):5'- CCATGCTGTTTGTCTCTATGTACAG -3'
Posted On 2014-03-28