Incidental Mutation 'R1481:Tctn2'
ID164363
Institutional Source Beutler Lab
Gene Symbol Tctn2
Ensembl Gene ENSMUSG00000029386
Gene Nametectonic family member 2
SynonymsTect2, 4432405B04Rik
MMRRC Submission 039534-MU
Accession Numbers

Genbank: NM_026486; MGI: 1915228

Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1481 (G1)
Quality Score179
Status Validated
Chromosome5
Chromosomal Location124598749-124628771 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) T to C at 124607763 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000100706
SMART Domains Protein: ENSMUSP00000098272
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 6.8e-75 PFAM
low complexity region 669 681 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130912
SMART Domains Protein: ENSMUSP00000114298
Gene: ENSMUSG00000029386

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:DUF1619 171 442 1.5e-75 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132090
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152822
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185820
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I membrane protein that belongs to the tectonic family. Studies in mice suggest that this protein may be involved in hedgehog signaling, and essential for ciliogenesis. Mutations in this gene are associated with Meckel syndrome type 8. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit open neural tubes, exencephaly, micropthalmia, cleft palate, preaxial polydactyly, ventricular septal defect, sight-sided stomach, absent floor plate, and cilia defects. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Tctn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01868:Tctn2 APN 5 124616528 exon noncoding transcript
IGL02154:Tctn2 APN 5 124608561 exon noncoding transcript
IGL02447:Tctn2 APN 5 124615253 exon noncoding transcript
3-1:Tctn2 UTSW 5 124615231 exon noncoding transcript
R0101:Tctn2 UTSW 5 124615294 splice site noncoding transcript
R0101:Tctn2 UTSW 5 124615294 splice site noncoding transcript
R1764:Tctn2 UTSW 5 124619031 splice site noncoding transcript
R1865:Tctn2 UTSW 5 124619080 exon noncoding transcript
R4467:Tctn2 UTSW 5 124620189 exon noncoding transcript
R5390:Tctn2 UTSW 5 124624335 unclassified probably benign
R5884:Tctn2 UTSW 5 124603832 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTCTTGCACCGCCAAGCACT -3'
(R):5'- TGTGAGCCAAGTCAAGAACCCAGTAA -3'

Sequencing Primer
(F):5'- GCCAAGCACTTGGGGAG -3'
(R):5'- AGGCAGTCCAGGTACTCAC -3'
Posted On2014-03-28