Incidental Mutation 'R1481:Eln'
ID164365
Institutional Source Beutler Lab
Gene Symbol Eln
Ensembl Gene ENSMUSG00000029675
Gene Nameelastin
SynonymsE030024M20Rik, tropoelastin
MMRRC Submission 039534-MU
Accession Numbers

Ncbi RefSeq: NM_007925.3; MGI:95317

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1481 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location134702593-134747323 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134706572 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 786 (K786E)
Ref Sequence ENSEMBL: ENSMUSP00000015138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015138] [ENSMUST00000201856]
Predicted Effect probably damaging
Transcript: ENSMUST00000015138
AA Change: K786E

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000015138
Gene: ENSMUSG00000029675
AA Change: K786E

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
low complexity region 224 264 N/A INTRINSIC
low complexity region 292 301 N/A INTRINSIC
low complexity region 312 446 N/A INTRINSIC
low complexity region 451 798 N/A INTRINSIC
low complexity region 818 849 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201856
SMART Domains Protein: ENSMUSP00000144555
Gene: ENSMUSG00000029675

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
low complexity region 183 220 N/A INTRINSIC
SCOP:d1iq0a2 227 280 8e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202570
Meta Mutation Damage Score 0.0719 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype Strain: 2153007
Lethality: 3- 4
FUNCTION: This gene encodes elastin, the extracellular matrix protein that forms a major structural component of several tissues including lungs and arterial walls. Cleavage of the signal peptide from the encoded precursor generates soluble tropoelastin which undergoes lysine-derived crosslinking to form elastin polymers. Mice lacking the encoded protein exhibit defective lung development, and die of an obstructive arterial disease resulting from subendothelial cell proliferation and reorganization of smooth muscle. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for null allele die in the early postnatal period of an obstructive arterial disease. They exhibit a decrease in arterial diameter due to subendothelial accumulation of arterial smooth muscle, and display defective terminal airway development resulting in emphysematous morphology. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Eln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01603:Eln APN 5 134719040 intron probably benign
IGL01941:Eln APN 5 134718170 intron probably benign
IGL02508:Eln APN 5 134704568 utr 3 prime probably benign
IGL02654:Eln APN 5 134717054 intron probably benign
PIT4696001:Eln UTSW 5 134737178 missense unknown
R0036:Eln UTSW 5 134711060 critical splice donor site probably null
R0594:Eln UTSW 5 134712398 splice site probably benign
R0849:Eln UTSW 5 134707981 nonsense probably null
R1434:Eln UTSW 5 134729437 splice site probably benign
R1682:Eln UTSW 5 134703782 makesense probably null
R1741:Eln UTSW 5 134729184 missense unknown
R1926:Eln UTSW 5 134706567 nonsense probably null
R1983:Eln UTSW 5 134736340 splice site probably null
R2033:Eln UTSW 5 134710106 critical splice donor site probably null
R2259:Eln UTSW 5 134729654 missense unknown
R2260:Eln UTSW 5 134729654 missense unknown
R4450:Eln UTSW 5 134725781 intron probably benign
R6502:Eln UTSW 5 134725774 intron probably benign
R7249:Eln UTSW 5 134711081 utr 3 prime probably benign
R7479:Eln UTSW 5 134707575 missense unknown
R7819:Eln UTSW 5 134737181 missense unknown
R7855:Eln UTSW 5 134711081 utr 3 prime probably benign
R7873:Eln UTSW 5 134711187 missense unknown
R7923:Eln UTSW 5 134711081 utr 3 prime probably benign
R8047:Eln UTSW 5 134729149 small deletion probably benign
R8048:Eln UTSW 5 134729149 small deletion probably benign
R8073:Eln UTSW 5 134729149 small deletion probably benign
R8141:Eln UTSW 5 134729149 small deletion probably benign
R8144:Eln UTSW 5 134729149 small deletion probably benign
R8344:Eln UTSW 5 134728392 missense unknown
R8413:Eln UTSW 5 134726521 missense unknown
Z1177:Eln UTSW 5 134718026 missense unknown
Predicted Primers PCR Primer
(F):5'- GTTTCCAGAACCCCACTGATTGTCC -3'
(R):5'- TGGAGTTCATTCCTAGCACCAGAGAG -3'

Sequencing Primer
(F):5'- ATACCTCCACCTGGGAATGG -3'
(R):5'- CAGAGACTATTAGAAAGATGGGTGTG -3'
Posted On2014-03-28