Mutagenetix > Incidental Mutation

Incidental Mutation 'R1481:Arhgef5'

164367

Institutional Source

Beutler Lab

Gene Symbol

Arhgef5

Ensembl Gene

ENSMUSG00000033542

Gene Name

Rho guanine nucleotide exchange factor (GEF) 5

Synonyms

2210412D05Rik

MMRRC Submission

039534-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1481 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

43265582-43289320 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 43274634 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 773 (H773R)

Ref Sequence

ENSEMBL: ENSMUSP00000031750 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031750]

AlphaFold

E9Q7D5

Predicted Effect

probably damaging
Transcript: ENSMUST00000031750
AA Change: H773R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000031750
Gene: ENSMUSG00000033542
AA Change: H773R

Domain	Start	End	E-Value	Type
Pfam:ARHGEF5_35	1	477	3.1e-220	PFAM
low complexity region	509	531	N/A	INTRINSIC
low complexity region	812	825	N/A	INTRINSIC
low complexity region	827	851	N/A	INTRINSIC
RhoGEF	1162	1341	2.97e-57	SMART
PH	1375	1488	1.11e-6	SMART
SH3	1497	1554	6.39e-15	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182190

Predicted Effect

unknown
Transcript: ENSMUST00000182924
AA Change: H41R

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183094

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183227

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203387

Meta Mutation Damage Score

0.0625

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein may be involved in the control of cytoskeletal organization. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased Th2 response in an ovalbumin-induced asthma model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 37,008,434	V3365A	probably damaging	Het
Bmp3	G	A	5: 98,872,470	V251M	probably damaging	Het
Ccdc175	C	A	12: 72,101,948		probably benign	Het
Ccdc178	C	T	18: 22,105,621	G313D	probably benign	Het
Cd300ld2	T	A	11: 115,012,633	I129F	probably benign	Het
Cep170	T	C	1: 176,782,385	Q120R	possibly damaging	Het
Ckb	T	C	12: 111,671,262	H145R	probably benign	Het
Cntnap5a	T	A	1: 116,117,663	N336K	probably damaging	Het
Coil	T	A	11: 88,974,060	C38S	possibly damaging	Het
Cps1	T	C	1: 67,143,882	V133A	probably damaging	Het
Cspg4	A	G	9: 56,887,810	E943G	probably damaging	Het
Cyp2c54	C	T	19: 40,047,588	D293N	probably benign	Het
Cyp2f2	T	C	7: 27,121,877	S72P	probably benign	Het
Dip2c	G	A	13: 9,551,866		probably null	Het
Dock6	T	C	9: 21,820,622	T1158A	probably benign	Het
Dscaml1	G	A	9: 45,672,643	V469I	probably benign	Het
Efcab14	A	G	4: 115,756,517	T221A	probably benign	Het
Ehbp1	T	C	11: 22,006,782	*1207W	probably null	Het
Eln	T	C	5: 134,706,572	K786E	probably damaging	Het
Fyb	C	T	15: 6,619,647	P385S	probably benign	Het
Galr1	A	G	18: 82,405,741	I137T	possibly damaging	Het
Gcm1	A	T	9: 78,059,717	K73*	probably null	Het
Gemin5	T	C	11: 58,141,654	N775D	probably damaging	Het
Gli3	C	T	13: 15,613,850	H147Y	probably damaging	Het
Gm10754	G	T	10: 97,682,227		probably benign	Het
Gpr37	T	C	6: 25,669,138	D569G	probably damaging	Het
Grina	T	A	15: 76,249,089	Y286N	probably damaging	Het
Gtf3c1	C	A	7: 125,693,138		probably null	Het
Kcnc4	C	T	3: 107,448,218	V305M	probably benign	Het
Kntc1	T	C	5: 123,778,275	F724L	probably benign	Het
Kpnb1	T	C	11: 97,178,310	Y249C	probably damaging	Het
Krt6b	T	C	15: 101,678,374	T269A	probably benign	Het
Lamc1	T	C	1: 153,221,634	K1555E	probably damaging	Het
Maneal	T	C	4: 124,861,857	Y104C	probably damaging	Het
Map1b	T	C	13: 99,431,171	T1681A	unknown	Het
Mettl17	T	C	14: 51,890,703	L272P	probably benign	Het
Mib2	T	A	4: 155,656,999	S357C	probably benign	Het
Mmp19	C	A	10: 128,798,178	T316K	possibly damaging	Het
Mroh9	C	T	1: 163,026,509	G774E	probably damaging	Het
Myh1	T	C	11: 67,205,499		probably benign	Het
Ncor2	C	A	5: 125,027,138	E963*	probably null	Het
Nol6	T	A	4: 41,123,596	T51S	probably benign	Het
Nsun3	A	T	16: 62,735,369	C265S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Nutm2	T	A	13: 50,469,481	N71K	probably damaging	Het
Olfr498	C	T	7: 108,465,960	T212I	probably benign	Het
Olfr713	T	G	7: 107,036,149	L5R	probably benign	Het
Orc3	T	A	4: 34,607,228	E34V	possibly damaging	Het
Pcdhb13	T	A	18: 37,442,836	L89Q	probably damaging	Het
Polr3a	A	T	14: 24,452,548	V1241E	probably null	Het
Prpf39	C	T	12: 65,053,314	P135S	probably damaging	Het
Psrc1	T	C	3: 108,384,993	V34A	probably benign	Het
Rab27a	G	A	9: 73,082,402	V52M	probably benign	Het
Rassf9	A	G	10: 102,546,034	T424A	probably benign	Het
Ripor3	G	T	2: 168,000,377	R61S	possibly damaging	Het
Ryr3	C	T	2: 112,636,522		probably benign	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Setbp1	C	T	18: 78,783,301	V1366M	probably benign	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Tctn2	T	C	5: 124,607,763		noncoding transcript	Het
Tmem45a	A	T	16: 56,811,602	F218I	possibly damaging	Het
Tpte	A	T	8: 22,355,471	R512S	probably damaging	Het
Trim37	T	A	11: 87,129,759	L22*	probably null	Het
Ttc6	A	G	12: 57,737,130	N1792D	probably damaging	Het
Ttn	A	G	2: 76,945,616	M1694T	probably damaging	Het
Vmn1r181	T	A	7: 23,984,712	W201R	probably damaging	Het
Wdr74	C	T	19: 8,738,228	L198F	possibly damaging	Het
Zfp560	T	C	9: 20,348,790	T259A	probably benign	Het

Other mutations in Arhgef5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Arhgef5	APN	6	43280269	nonsense	probably null
IGL01341:Arhgef5	APN	6	43283991	missense	probably damaging	1.00
IGL01576:Arhgef5	APN	6	43274028	missense	probably benign	0.38
IGL01761:Arhgef5	APN	6	43274604	missense	probably benign	0.00
IGL02104:Arhgef5	APN	6	43272411	missense	probably damaging	0.99
IGL02208:Arhgef5	APN	6	43275130	missense	probably benign	0.11
IGL02487:Arhgef5	APN	6	43283982	missense	probably damaging	1.00
IGL02650:Arhgef5	APN	6	43272935	nonsense	probably null
IGL03292:Arhgef5	APN	6	43280246	missense	probably damaging	1.00
IGL03334:Arhgef5	APN	6	43274000	missense	possibly damaging	0.47
IGL03341:Arhgef5	APN	6	43280651	missense	probably damaging	0.99
R0047:Arhgef5	UTSW	6	43265621	splice site	probably null
R0206:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0208:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R0698:Arhgef5	UTSW	6	43273341	missense	probably damaging	1.00
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1145:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R1168:Arhgef5	UTSW	6	43273396	missense	probably benign	0.00
R1355:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1370:Arhgef5	UTSW	6	43283912	missense	probably damaging	1.00
R1529:Arhgef5	UTSW	6	43279515	missense	probably damaging	0.96
R1532:Arhgef5	UTSW	6	43273403	missense	probably benign
R1663:Arhgef5	UTSW	6	43276965	missense	probably damaging	1.00
R1742:Arhgef5	UTSW	6	43280199	missense	probably damaging	1.00
R1852:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R1869:Arhgef5	UTSW	6	43288682	missense	probably damaging	1.00
R1880:Arhgef5	UTSW	6	43273088	missense	possibly damaging	0.92
R2146:Arhgef5	UTSW	6	43283318	missense	probably damaging	1.00
R2169:Arhgef5	UTSW	6	43274420	missense	probably benign	0.11
R3412:Arhgef5	UTSW	6	43273790	missense	probably benign
R4205:Arhgef5	UTSW	6	43273832	missense	possibly damaging	0.76
R4226:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4227:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4304:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4308:Arhgef5	UTSW	6	43279498	missense	probably damaging	1.00
R4457:Arhgef5	UTSW	6	43274093	missense	probably damaging	1.00
R4469:Arhgef5	UTSW	6	43275099	missense	probably benign
R4636:Arhgef5	UTSW	6	43274942	missense	probably benign	0.11
R4791:Arhgef5	UTSW	6	43283183	missense	probably damaging	1.00
R4818:Arhgef5	UTSW	6	43273550	missense	probably benign	0.00
R4910:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R4911:Arhgef5	UTSW	6	43272828	missense	probably benign	0.01
R5127:Arhgef5	UTSW	6	43273214	missense	probably damaging	0.99
R5209:Arhgef5	UTSW	6	43273700	missense	probably benign	0.01
R5245:Arhgef5	UTSW	6	43265680	start gained	probably benign
R5251:Arhgef5	UTSW	6	43272881	missense	possibly damaging	0.76
R5513:Arhgef5	UTSW	6	43272339	missense	probably damaging	0.96
R5613:Arhgef5	UTSW	6	43274063	missense	probably benign	0.01
R5616:Arhgef5	UTSW	6	43275940	missense	probably benign	0.20
R5817:Arhgef5	UTSW	6	43275104	missense	probably benign	0.15
R6024:Arhgef5	UTSW	6	43275134	missense	probably benign	0.00
R6735:Arhgef5	UTSW	6	43275032	missense	probably benign	0.01
R6825:Arhgef5	UTSW	6	43274961	missense	probably damaging	0.99
R6831:Arhgef5	UTSW	6	43280999	missense	probably damaging	1.00
R6901:Arhgef5	UTSW	6	43273298	missense	probably benign	0.00
R6932:Arhgef5	UTSW	6	43274417	missense	possibly damaging	0.94
R6968:Arhgef5	UTSW	6	43275342	missense	probably benign	0.00
R7018:Arhgef5	UTSW	6	43288731	missense	probably damaging	1.00
R7180:Arhgef5	UTSW	6	43275208	missense	possibly damaging	0.87
R7201:Arhgef5	UTSW	6	43273232	nonsense	probably null
R7358:Arhgef5	UTSW	6	43279573	missense	probably damaging	1.00
R7359:Arhgef5	UTSW	6	43280282	missense	probably damaging	1.00
R7468:Arhgef5	UTSW	6	43280671	nonsense	probably null
R7503:Arhgef5	UTSW	6	43273999	missense	probably benign	0.15
R7699:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7700:Arhgef5	UTSW	6	43274757	missense	probably benign	0.11
R7737:Arhgef5	UTSW	6	43273794	missense	possibly damaging	0.84
R7847:Arhgef5	UTSW	6	43275135	nonsense	probably null
R7950:Arhgef5	UTSW	6	43273925	missense	possibly damaging	0.76
R8161:Arhgef5	UTSW	6	43283951	missense	probably damaging	1.00
R8178:Arhgef5	UTSW	6	43275185	missense	probably benign	0.00
R8203:Arhgef5	UTSW	6	43280645	missense	probably damaging	1.00
R8318:Arhgef5	UTSW	6	43275999	critical splice donor site	probably null
R8857:Arhgef5	UTSW	6	43287624	missense	probably damaging	1.00
R9499:Arhgef5	UTSW	6	43284006	missense
RF023:Arhgef5	UTSW	6	43279473	missense	probably damaging	1.00
X0028:Arhgef5	UTSW	6	43273701	missense	probably benign	0.03
X0065:Arhgef5	UTSW	6	43272408	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CCACAGAACTCAGCCTTTGCCATAG -3'
(R):5'- TGGCTTGGCTTGACCTCCTGAATG -3'

Sequencing Primer
(F):5'- CCATAGGCTCTCCTGCAAATG -3'
(R):5'- GGCTTGACCTCCTGAATGTATAAC -3'

Posted On

2014-03-28