Incidental Mutation 'R1481:Smad1'
ID 164375
Institutional Source Beutler Lab
Gene Symbol Smad1
Ensembl Gene ENSMUSG00000031681
Gene Name SMAD family member 1
Synonyms Madh1, Smad 1, Madr1
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 79338395-79399518 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 79343730 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 393 (A393V)
Ref Sequence ENSEMBL: ENSMUSP00000105511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066091] [ENSMUST00000109885]
AlphaFold P70340
Predicted Effect probably benign
Transcript: ENSMUST00000066091
AA Change: A393V

PolyPhen 2 Score 0.094 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071035
Gene: ENSMUSG00000031681
AA Change: A393V

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 441 2.73e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109885
AA Change: A393V

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000105511
Gene: ENSMUSG00000031681
AA Change: A393V

DomainStartEndE-ValueType
DWA 25 134 6.94e-68 SMART
low complexity region 179 212 N/A INTRINSIC
low complexity region 219 233 N/A INTRINSIC
DWB 269 425 3.92e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210678
Meta Mutation Damage Score 0.0871 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signals of the bone morphogenetic proteins (BMPs), which are involved in a range of biological activities including cell growth, apoptosis, morphogenesis, development and immune responses. In response to BMP ligands, this protein can be phosphorylated and activated by the BMP receptor kinase. The phosphorylated form of this protein forms a complex with SMAD4, which is important for its function in the transcription regulation. This protein is a target for SMAD-specific E3 ubiquitin ligases, such as SMURF1 and SMURF2, and undergoes ubiquitination and proteasome-mediated degradation. Alternatively spliced transcript variants encoding the same protein have been observed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired allantois formation resulting in the lack of a placenta, and die around embryonic day 9-10. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Smad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Smad1 APN 8 79356469 missense probably damaging 0.97
IGL01792:Smad1 APN 8 79372123 missense probably damaging 1.00
R0395:Smad1 UTSW 8 79349782 missense probably benign 0.01
R0400:Smad1 UTSW 8 79371770 splice site probably benign
R0990:Smad1 UTSW 8 79343788 missense probably damaging 1.00
R1371:Smad1 UTSW 8 79349578 splice site probably benign
R1661:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1665:Smad1 UTSW 8 79372029 missense probably damaging 1.00
R1797:Smad1 UTSW 8 79343844 missense probably damaging 1.00
R2879:Smad1 UTSW 8 79353455 splice site probably null
R3624:Smad1 UTSW 8 79339698 missense probably benign 0.31
R3791:Smad1 UTSW 8 79339770 missense probably damaging 1.00
R3815:Smad1 UTSW 8 79343730 missense probably benign 0.20
R3819:Smad1 UTSW 8 79343730 missense probably benign 0.20
R4887:Smad1 UTSW 8 79349752 missense probably damaging 1.00
R5438:Smad1 UTSW 8 79356320 missense probably benign 0.19
R8836:Smad1 UTSW 8 79371925 missense probably damaging 1.00
R9308:Smad1 UTSW 8 79372270 start gained probably benign
X0064:Smad1 UTSW 8 79353404 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCACAGATTTACATGTTGTGAGAAGGC -3'
(R):5'- CTGAACAGACTGGCTGACACAAGG -3'

Sequencing Primer
(F):5'- GCATATGTGTATGGGGGAAGTA -3'
(R):5'- GCAGGAGTCCACCTTTATTACG -3'
Posted On 2014-03-28