Mutagenetix > Incidental Mutation

Incidental Mutation 'R1481:Coil'

164390

Institutional Source

Beutler Lab

Gene Symbol

Coil

Ensembl Gene

ENSMUSG00000033983

Gene Name

coilin

Synonyms

Cln80, p80-coilin

MMRRC Submission

039534-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R1481 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

88970252-88991613 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88974060 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 38 (C38S)

Ref Sequence

ENSEMBL: ENSMUSP00000103530 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036649] [ENSMUST00000107898]

AlphaFold

Q5SU73

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036649
AA Change: C38S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000047588
Gene: ENSMUSG00000033983
AA Change: C38S

Domain	Start	End	E-Value	Type
low complexity region	54	70	N/A	INTRINSIC
low complexity region	161	167	N/A	INTRINSIC
low complexity region	174	195	N/A	INTRINSIC
low complexity region	300	322	N/A	INTRINSIC
low complexity region	401	417	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107898
AA Change: C38S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103530
Gene: ENSMUSG00000033983
AA Change: C38S

Domain	Start	End	E-Value	Type
Pfam:Coilin_N	10	220	8.7e-35	PFAM
low complexity region	303	325	N/A	INTRINSIC
low complexity region	404	420	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122062

Meta Mutation Damage Score

0.4538

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.3%
20x: 92.6%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral component of Cajal bodies (also called coiled bodies). Cajal bodies are nuclear suborganelles of varying number and composition that are involved in the post-transcriptional modification of small nuclear and small nucleolar RNAs. The N-terminus of the coilin protein directs its self-oligomerization while the C-terminus influences the number of nuclear bodies assembled per cell. Differential methylation and phosphorylation of coilin likely influences its localization among nuclear bodies and the composition and assembly of Cajal bodies. This gene has pseudogenes on chromosome 4 and chromosome 14. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show reduced viability on inbred backgrounds. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4932438A13Rik	T	C	3: 37,008,434	V3365A	probably damaging	Het
Arhgef5	A	G	6: 43,274,634	H773R	probably damaging	Het
Bmp3	G	A	5: 98,872,470	V251M	probably damaging	Het
Ccdc175	C	A	12: 72,101,948		probably benign	Het
Ccdc178	C	T	18: 22,105,621	G313D	probably benign	Het
Cd300ld2	T	A	11: 115,012,633	I129F	probably benign	Het
Cep170	T	C	1: 176,782,385	Q120R	possibly damaging	Het
Ckb	T	C	12: 111,671,262	H145R	probably benign	Het
Cntnap5a	T	A	1: 116,117,663	N336K	probably damaging	Het
Cps1	T	C	1: 67,143,882	V133A	probably damaging	Het
Cspg4	A	G	9: 56,887,810	E943G	probably damaging	Het
Cyp2c54	C	T	19: 40,047,588	D293N	probably benign	Het
Cyp2f2	T	C	7: 27,121,877	S72P	probably benign	Het
Dip2c	G	A	13: 9,551,866		probably null	Het
Dock6	T	C	9: 21,820,622	T1158A	probably benign	Het
Dscaml1	G	A	9: 45,672,643	V469I	probably benign	Het
Efcab14	A	G	4: 115,756,517	T221A	probably benign	Het
Ehbp1	T	C	11: 22,006,782	*1207W	probably null	Het
Eln	T	C	5: 134,706,572	K786E	probably damaging	Het
Fyb	C	T	15: 6,619,647	P385S	probably benign	Het
Galr1	A	G	18: 82,405,741	I137T	possibly damaging	Het
Gcm1	A	T	9: 78,059,717	K73*	probably null	Het
Gemin5	T	C	11: 58,141,654	N775D	probably damaging	Het
Gli3	C	T	13: 15,613,850	H147Y	probably damaging	Het
Gm10754	G	T	10: 97,682,227		probably benign	Het
Gpr37	T	C	6: 25,669,138	D569G	probably damaging	Het
Grina	T	A	15: 76,249,089	Y286N	probably damaging	Het
Gtf3c1	C	A	7: 125,693,138		probably null	Het
Kcnc4	C	T	3: 107,448,218	V305M	probably benign	Het
Kntc1	T	C	5: 123,778,275	F724L	probably benign	Het
Kpnb1	T	C	11: 97,178,310	Y249C	probably damaging	Het
Krt6b	T	C	15: 101,678,374	T269A	probably benign	Het
Lamc1	T	C	1: 153,221,634	K1555E	probably damaging	Het
Maneal	T	C	4: 124,861,857	Y104C	probably damaging	Het
Map1b	T	C	13: 99,431,171	T1681A	unknown	Het
Mettl17	T	C	14: 51,890,703	L272P	probably benign	Het
Mib2	T	A	4: 155,656,999	S357C	probably benign	Het
Mmp19	C	A	10: 128,798,178	T316K	possibly damaging	Het
Mroh9	C	T	1: 163,026,509	G774E	probably damaging	Het
Myh1	T	C	11: 67,205,499		probably benign	Het
Ncor2	C	A	5: 125,027,138	E963*	probably null	Het
Nol6	T	A	4: 41,123,596	T51S	probably benign	Het
Nsun3	A	T	16: 62,735,369	C265S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Nutm2	T	A	13: 50,469,481	N71K	probably damaging	Het
Olfr498	C	T	7: 108,465,960	T212I	probably benign	Het
Olfr713	T	G	7: 107,036,149	L5R	probably benign	Het
Orc3	T	A	4: 34,607,228	E34V	possibly damaging	Het
Pcdhb13	T	A	18: 37,442,836	L89Q	probably damaging	Het
Polr3a	A	T	14: 24,452,548	V1241E	probably null	Het
Prpf39	C	T	12: 65,053,314	P135S	probably damaging	Het
Psrc1	T	C	3: 108,384,993	V34A	probably benign	Het
Rab27a	G	A	9: 73,082,402	V52M	probably benign	Het
Rassf9	A	G	10: 102,546,034	T424A	probably benign	Het
Ripor3	G	T	2: 168,000,377	R61S	possibly damaging	Het
Ryr3	C	T	2: 112,636,522		probably benign	Het
Samd4b	C	T	7: 28,414,010	G177R	probably damaging	Het
Setbp1	C	T	18: 78,783,301	V1366M	probably benign	Het
Smad1	G	A	8: 79,343,730	A393V	probably benign	Het
Tctn2	T	C	5: 124,607,763		noncoding transcript	Het
Tmem45a	A	T	16: 56,811,602	F218I	possibly damaging	Het
Tpte	A	T	8: 22,355,471	R512S	probably damaging	Het
Trim37	T	A	11: 87,129,759	L22*	probably null	Het
Ttc6	A	G	12: 57,737,130	N1792D	probably damaging	Het
Ttn	A	G	2: 76,945,616	M1694T	probably damaging	Het
Vmn1r181	T	A	7: 23,984,712	W201R	probably damaging	Het
Wdr74	C	T	19: 8,738,228	L198F	possibly damaging	Het
Zfp560	T	C	9: 20,348,790	T259A	probably benign	Het

Other mutations in Coil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02238:Coil	APN	11	88981754	missense	probably benign	0.02
PIT4519001:Coil	UTSW	11	88972726	start gained	probably benign
PIT4520001:Coil	UTSW	11	88981611	missense	probably benign	0.01
R0122:Coil	UTSW	11	88985007	splice site	probably benign
R0211:Coil	UTSW	11	88982153	missense	probably damaging	1.00
R0288:Coil	UTSW	11	88981868	missense	probably damaging	1.00
R0396:Coil	UTSW	11	88981623	missense	probably benign
R0416:Coil	UTSW	11	88981986	missense	possibly damaging	0.55
R1251:Coil	UTSW	11	88982299	missense	possibly damaging	0.93
R1705:Coil	UTSW	11	88974136	missense	probably damaging	1.00
R1728:Coil	UTSW	11	88973976	missense	probably damaging	0.98
R1824:Coil	UTSW	11	88982097	missense	possibly damaging	0.91
R2989:Coil	UTSW	11	88987979	missense	probably damaging	1.00
R3819:Coil	UTSW	11	88981793	missense	probably benign	0.07
R5217:Coil	UTSW	11	88981161	missense	possibly damaging	0.94
R6997:Coil	UTSW	11	88981847	missense	probably benign
R7050:Coil	UTSW	11	88981188	missense	possibly damaging	0.87
R8504:Coil	UTSW	11	88981154	nonsense	probably null
R9564:Coil	UTSW	11	88981800	missense	possibly damaging	0.52
RF007:Coil	UTSW	11	88981830	small deletion	probably benign
Z1176:Coil	UTSW	11	88981976	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGGAGCCTTACAGACCTACTTG -3'
(R):5'- GGCATATTTGCGCCATGCACAC -3'

Sequencing Primer
(F):5'- TACAGACCTACTTGCGCCC -3'
(R):5'- GTTTAGTCCCCCTGAAATGAGAAG -3'

Posted On

2014-03-28