Incidental Mutation 'R1481:Coil'
ID 164390
Institutional Source Beutler Lab
Gene Symbol Coil
Ensembl Gene ENSMUSG00000033983
Gene Name coilin
Synonyms Cln80, p80-coilin
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 88970252-88991613 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 88974060 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 38 (C38S)
Ref Sequence ENSEMBL: ENSMUSP00000103530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036649] [ENSMUST00000107898]
AlphaFold Q5SU73
Predicted Effect possibly damaging
Transcript: ENSMUST00000036649
AA Change: C38S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047588
Gene: ENSMUSG00000033983
AA Change: C38S

DomainStartEndE-ValueType
low complexity region 54 70 N/A INTRINSIC
low complexity region 161 167 N/A INTRINSIC
low complexity region 174 195 N/A INTRINSIC
low complexity region 300 322 N/A INTRINSIC
low complexity region 401 417 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107898
AA Change: C38S

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103530
Gene: ENSMUSG00000033983
AA Change: C38S

DomainStartEndE-ValueType
Pfam:Coilin_N 10 220 8.7e-35 PFAM
low complexity region 303 325 N/A INTRINSIC
low complexity region 404 420 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122062
Meta Mutation Damage Score 0.4538 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an integral component of Cajal bodies (also called coiled bodies). Cajal bodies are nuclear suborganelles of varying number and composition that are involved in the post-transcriptional modification of small nuclear and small nucleolar RNAs. The N-terminus of the coilin protein directs its self-oligomerization while the C-terminus influences the number of nuclear bodies assembled per cell. Differential methylation and phosphorylation of coilin likely influences its localization among nuclear bodies and the composition and assembly of Cajal bodies. This gene has pseudogenes on chromosome 4 and chromosome 14. [provided by RefSeq, Jul 2008]
PHENOTYPE: Animals homozygous for a mutation in this gene show reduced viability on inbred backgrounds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Coil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02238:Coil APN 11 88981754 missense probably benign 0.02
PIT4519001:Coil UTSW 11 88972726 start gained probably benign
PIT4520001:Coil UTSW 11 88981611 missense probably benign 0.01
R0122:Coil UTSW 11 88985007 splice site probably benign
R0211:Coil UTSW 11 88982153 missense probably damaging 1.00
R0288:Coil UTSW 11 88981868 missense probably damaging 1.00
R0396:Coil UTSW 11 88981623 missense probably benign
R0416:Coil UTSW 11 88981986 missense possibly damaging 0.55
R1251:Coil UTSW 11 88982299 missense possibly damaging 0.93
R1705:Coil UTSW 11 88974136 missense probably damaging 1.00
R1728:Coil UTSW 11 88973976 missense probably damaging 0.98
R1824:Coil UTSW 11 88982097 missense possibly damaging 0.91
R2989:Coil UTSW 11 88987979 missense probably damaging 1.00
R3819:Coil UTSW 11 88981793 missense probably benign 0.07
R5217:Coil UTSW 11 88981161 missense possibly damaging 0.94
R6997:Coil UTSW 11 88981847 missense probably benign
R7050:Coil UTSW 11 88981188 missense possibly damaging 0.87
R8504:Coil UTSW 11 88981154 nonsense probably null
R9564:Coil UTSW 11 88981800 missense possibly damaging 0.52
RF007:Coil UTSW 11 88981830 small deletion probably benign
Z1176:Coil UTSW 11 88981976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGGAGCCTTACAGACCTACTTG -3'
(R):5'- GGCATATTTGCGCCATGCACAC -3'

Sequencing Primer
(F):5'- TACAGACCTACTTGCGCCC -3'
(R):5'- GTTTAGTCCCCCTGAAATGAGAAG -3'
Posted On 2014-03-28