Incidental Mutation 'R1481:Kpnb1'
ID 164391
Institutional Source Beutler Lab
Gene Symbol Kpnb1
Ensembl Gene ENSMUSG00000001440
Gene Name karyopherin (importin) beta 1
Synonyms Impnb
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 97159714-97187881 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 97178310 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 249 (Y249C)
Ref Sequence ENSEMBL: ENSMUSP00000001479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001479]
AlphaFold P70168
PDB Structure N-TERMINAL FRAGMENT OF IMPORTIN-BETA [X-RAY DIFFRACTION]
Crystal structure of Importin-beta and SREBP-2 complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000001479
AA Change: Y249C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001479
Gene: ENSMUSG00000001440
AA Change: Y249C

DomainStartEndE-ValueType
IBN_N 21 101 3.72e-5 SMART
Blast:ARM 158 203 4e-7 BLAST
Pfam:HEAT_EZ 380 435 3e-13 PFAM
Pfam:HEAT 409 439 2.6e-7 PFAM
Blast:ARM 440 477 7e-17 BLAST
low complexity region 478 495 N/A INTRINSIC
Blast:IBN_N 528 590 9e-25 BLAST
Blast:ARM 594 637 1e-18 BLAST
Blast:ARM 784 827 1e-5 BLAST
Meta Mutation Damage Score 0.7123 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Homozygous mutation of this gene results in lethality shortly after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Kpnb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Kpnb1 APN 11 97166102 missense probably damaging 1.00
IGL01919:Kpnb1 APN 11 97164730 missense probably benign
IGL02161:Kpnb1 APN 11 97168936 missense probably benign 0.01
IGL02679:Kpnb1 APN 11 97177260 missense possibly damaging 0.92
IGL02866:Kpnb1 APN 11 97177286 missense probably damaging 0.99
IGL02899:Kpnb1 APN 11 97175786 missense probably damaging 1.00
R0373:Kpnb1 UTSW 11 97185090 missense probably damaging 1.00
R0542:Kpnb1 UTSW 11 97187572 missense probably benign 0.12
R0724:Kpnb1 UTSW 11 97178304 missense probably damaging 1.00
R0825:Kpnb1 UTSW 11 97171675 missense probably damaging 0.98
R0853:Kpnb1 UTSW 11 97187411 missense probably damaging 0.97
R3802:Kpnb1 UTSW 11 97166129 missense possibly damaging 0.92
R4458:Kpnb1 UTSW 11 97169170 missense probably damaging 1.00
R4490:Kpnb1 UTSW 11 97171598 missense probably benign
R4757:Kpnb1 UTSW 11 97177334 missense possibly damaging 0.65
R5500:Kpnb1 UTSW 11 97173111 missense possibly damaging 0.94
R6360:Kpnb1 UTSW 11 97173270 missense probably benign
R6494:Kpnb1 UTSW 11 97181648 missense probably benign 0.04
R7678:Kpnb1 UTSW 11 97169173 missense probably damaging 1.00
R8171:Kpnb1 UTSW 11 97175747 critical splice donor site probably null
R8874:Kpnb1 UTSW 11 97165383 missense probably benign 0.25
R9318:Kpnb1 UTSW 11 97163458 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAAAGAAAGCAGACATCTTCTTGGCA -3'
(R):5'- GGGTAGCACCAGTAGGTTTAACCCTTC -3'

Sequencing Primer
(F):5'- ccattcatcaggggactcac -3'
(R):5'- CTCATGGTACATGGAGGGGG -3'
Posted On 2014-03-28