Incidental Mutation 'R1481:Dip2c'
ID164397
Institutional Source Beutler Lab
Gene Symbol Dip2c
Ensembl Gene ENSMUSG00000048264
Gene Namedisco interacting protein 2 homolog C
Synonyms2900024P20Rik
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.585) question?
Stock #R1481 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location9276528-9668928 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 9551866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]
Predicted Effect probably null
Transcript: ENSMUST00000166299
SMART Domains Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 801 3.6e-23 PFAM
Pfam:AMP-binding 977 1451 1.5e-72 PFAM
low complexity region 1514 1526 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000169960
SMART Domains Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 176 3.02e-37 SMART
low complexity region 226 243 N/A INTRINSIC
low complexity region 331 343 N/A INTRINSIC
Pfam:AMP-binding 380 637 5.9e-10 PFAM
SCOP:d1lci__ 675 875 2e-8 SMART
Pfam:AMP-binding 947 1421 1.2e-56 PFAM
low complexity region 1484 1496 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174552
SMART Domains Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264

DomainStartEndE-ValueType
DMAP_binding 7 120 3.55e-43 SMART
low complexity region 170 187 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
Pfam:AMP-binding 324 800 2.7e-20 PFAM
Pfam:AMP-binding 976 1450 1.3e-56 PFAM
low complexity region 1513 1525 N/A INTRINSIC
Meta Mutation Damage Score 0.9487 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Fyb C T 15: 6,619,647 P385S probably benign Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Dip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Dip2c APN 13 9493108 missense probably damaging 0.97
IGL00426:Dip2c APN 13 9606515 missense probably damaging 1.00
IGL00503:Dip2c APN 13 9567898 missense probably damaging 1.00
IGL00586:Dip2c APN 13 9610755 missense probably damaging 1.00
IGL01306:Dip2c APN 13 9575143 missense possibly damaging 0.72
IGL01580:Dip2c APN 13 9637088 splice site probably null
IGL01985:Dip2c APN 13 9553267 splice site probably benign
IGL02060:Dip2c APN 13 9622630 missense probably damaging 0.98
IGL02122:Dip2c APN 13 9506659 missense possibly damaging 0.48
IGL02170:Dip2c APN 13 9606335 missense probably benign 0.03
IGL02211:Dip2c APN 13 9610847 missense probably damaging 1.00
IGL02755:Dip2c APN 13 9550320 critical splice donor site probably null
IGL02836:Dip2c APN 13 9610790 missense probably damaging 0.98
IGL02935:Dip2c APN 13 9662146 missense probably damaging 1.00
IGL03032:Dip2c APN 13 9551778 missense probably damaging 1.00
ANU23:Dip2c UTSW 13 9575143 missense possibly damaging 0.72
P0038:Dip2c UTSW 13 9646982 missense probably damaging 1.00
R0009:Dip2c UTSW 13 9621903 missense probably damaging 1.00
R0268:Dip2c UTSW 13 9637150 missense probably damaging 1.00
R0271:Dip2c UTSW 13 9615775 missense probably damaging 1.00
R0306:Dip2c UTSW 13 9604599 missense probably benign 0.09
R0415:Dip2c UTSW 13 9568289 splice site probably benign
R0519:Dip2c UTSW 13 9563208 missense probably damaging 1.00
R0557:Dip2c UTSW 13 9553459 missense possibly damaging 0.81
R0964:Dip2c UTSW 13 9568663 missense probably benign 0.43
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0973:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R0974:Dip2c UTSW 13 9576908 missense probably damaging 0.99
R1101:Dip2c UTSW 13 9634744 missense probably damaging 1.00
R1171:Dip2c UTSW 13 9493126 missense possibly damaging 0.89
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1403:Dip2c UTSW 13 9553264 splice site probably null
R1432:Dip2c UTSW 13 9553304 missense probably damaging 0.99
R1588:Dip2c UTSW 13 9665864 missense probably damaging 1.00
R1721:Dip2c UTSW 13 9659368 missense probably damaging 1.00
R1726:Dip2c UTSW 13 9575428 missense probably damaging 1.00
R1867:Dip2c UTSW 13 9621949 missense possibly damaging 0.55
R1909:Dip2c UTSW 13 9533350 missense probably benign 0.00
R2013:Dip2c UTSW 13 9567846 nonsense probably null
R2022:Dip2c UTSW 13 9551800 missense probably damaging 1.00
R2517:Dip2c UTSW 13 9609005 missense probably damaging 1.00
R3746:Dip2c UTSW 13 9601473 missense probably damaging 1.00
R3794:Dip2c UTSW 13 9604561 missense probably damaging 0.99
R3884:Dip2c UTSW 13 9551858 missense probably damaging 1.00
R4019:Dip2c UTSW 13 9614365 missense probably damaging 0.99
R4110:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4111:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4113:Dip2c UTSW 13 9637101 missense probably damaging 1.00
R4256:Dip2c UTSW 13 9609056 missense probably damaging 1.00
R4300:Dip2c UTSW 13 9610711 missense probably damaging 1.00
R4494:Dip2c UTSW 13 9571062 missense possibly damaging 0.64
R4739:Dip2c UTSW 13 9533339 missense probably damaging 0.98
R4812:Dip2c UTSW 13 9637130 nonsense probably null
R4814:Dip2c UTSW 13 9536860 missense probably benign 0.07
R4816:Dip2c UTSW 13 9575150 missense probably benign 0.37
R4828:Dip2c UTSW 13 9560679 missense probably damaging 1.00
R4915:Dip2c UTSW 13 9621869 splice site probably null
R4917:Dip2c UTSW 13 9621869 splice site probably null
R4932:Dip2c UTSW 13 9623972 missense probably damaging 0.99
R4993:Dip2c UTSW 13 9575223 nonsense probably null
R5043:Dip2c UTSW 13 9551827 missense possibly damaging 0.80
R5349:Dip2c UTSW 13 9622653 missense probably damaging 1.00
R5744:Dip2c UTSW 13 9568405 missense probably damaging 1.00
R5840:Dip2c UTSW 13 9506676 missense possibly damaging 0.68
R6110:Dip2c UTSW 13 9623766 missense probably damaging 1.00
R6160:Dip2c UTSW 13 9533254 missense probably benign 0.01
R6161:Dip2c UTSW 13 9647007 missense probably damaging 1.00
R6477:Dip2c UTSW 13 9623760 missense probably damaging 1.00
R6522:Dip2c UTSW 13 9575228 critical splice donor site probably null
R6603:Dip2c UTSW 13 9654588 splice site probably null
R6658:Dip2c UTSW 13 9493177 critical splice donor site probably null
R6672:Dip2c UTSW 13 9567830 critical splice acceptor site probably null
R6697:Dip2c UTSW 13 9621913 missense probably damaging 1.00
R6991:Dip2c UTSW 13 9551860 nonsense probably null
R6991:Dip2c UTSW 13 9634832 missense probably damaging 1.00
R7018:Dip2c UTSW 13 9659278 missense probably damaging 1.00
R7053:Dip2c UTSW 13 9610704 missense probably damaging 1.00
R7102:Dip2c UTSW 13 9604536 missense probably benign 0.01
R7171:Dip2c UTSW 13 9506648 missense probably benign 0.34
R7371:Dip2c UTSW 13 9592749 missense probably benign 0.02
R7395:Dip2c UTSW 13 9614377 missense probably damaging 1.00
R7489:Dip2c UTSW 13 9533312 missense probably damaging 0.99
R7575:Dip2c UTSW 13 9628012 missense probably damaging 0.97
R7642:Dip2c UTSW 13 9622705 critical splice donor site probably null
R7687:Dip2c UTSW 13 9604581 missense probably benign 0.00
R7699:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7700:Dip2c UTSW 13 9659311 missense probably benign 0.00
R7715:Dip2c UTSW 13 9614391 missense probably damaging 1.00
R7842:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7845:Dip2c UTSW 13 9609044 missense probably damaging 1.00
R7925:Dip2c UTSW 13 9606533 critical splice donor site probably null
R7928:Dip2c UTSW 13 9609044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACAGGTCAGTGCTTAGACACG -3'
(R):5'- GGGCAGATGGCTTCAAAGCTCTAAC -3'

Sequencing Primer
(F):5'- GCCTTATGATGTATTCCCATGACAG -3'
(R):5'- AGCTCTAACTGCATAGCACTTGG -3'
Posted On2014-03-28