Incidental Mutation 'R1481:Fyb'
ID 164403
Institutional Source Beutler Lab
Gene Symbol Fyb
Ensembl Gene ENSMUSG00000022148
Gene Name FYN binding protein
Synonyms B630013F22Rik, ADAP, FYB-120/130
MMRRC Submission 039534-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 6522853-6663313 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 6619647 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 385 (P385S)
Ref Sequence ENSEMBL: ENSMUSP00000087947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090461] [ENSMUST00000160612]
AlphaFold O35601
Predicted Effect probably benign
Transcript: ENSMUST00000090461
AA Change: P385S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087947
Gene: ENSMUSG00000022148
AA Change: P385S

DomainStartEndE-ValueType
low complexity region 67 85 N/A INTRINSIC
low complexity region 149 160 N/A INTRINSIC
low complexity region 236 246 N/A INTRINSIC
low complexity region 335 353 N/A INTRINSIC
low complexity region 371 409 N/A INTRINSIC
low complexity region 440 451 N/A INTRINSIC
low complexity region 457 494 N/A INTRINSIC
SH3 502 559 1.24e-3 SMART
low complexity region 611 626 N/A INTRINSIC
Pfam:hSH3 731 819 2.9e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160612
SMART Domains Protein: ENSMUSP00000124553
Gene: ENSMUSG00000022148

DomainStartEndE-ValueType
low complexity region 27 65 N/A INTRINSIC
low complexity region 96 107 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162430
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: The protein encoded by this gene is an adapter molecule that affects T cell receptor signaling and contains multiple protein-protein interaction domains. It is thought to couple T cell receptor stimulation with activation of integrin function. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased T cell proliferation, thymocytes and platelet counts and decreased TCR-stimulated leukocyte adhesion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik T C 3: 37,008,434 V3365A probably damaging Het
Arhgef5 A G 6: 43,274,634 H773R probably damaging Het
Bmp3 G A 5: 98,872,470 V251M probably damaging Het
Ccdc175 C A 12: 72,101,948 probably benign Het
Ccdc178 C T 18: 22,105,621 G313D probably benign Het
Cd300ld2 T A 11: 115,012,633 I129F probably benign Het
Cep170 T C 1: 176,782,385 Q120R possibly damaging Het
Ckb T C 12: 111,671,262 H145R probably benign Het
Cntnap5a T A 1: 116,117,663 N336K probably damaging Het
Coil T A 11: 88,974,060 C38S possibly damaging Het
Cps1 T C 1: 67,143,882 V133A probably damaging Het
Cspg4 A G 9: 56,887,810 E943G probably damaging Het
Cyp2c54 C T 19: 40,047,588 D293N probably benign Het
Cyp2f2 T C 7: 27,121,877 S72P probably benign Het
Dip2c G A 13: 9,551,866 probably null Het
Dock6 T C 9: 21,820,622 T1158A probably benign Het
Dscaml1 G A 9: 45,672,643 V469I probably benign Het
Efcab14 A G 4: 115,756,517 T221A probably benign Het
Ehbp1 T C 11: 22,006,782 *1207W probably null Het
Eln T C 5: 134,706,572 K786E probably damaging Het
Galr1 A G 18: 82,405,741 I137T possibly damaging Het
Gcm1 A T 9: 78,059,717 K73* probably null Het
Gemin5 T C 11: 58,141,654 N775D probably damaging Het
Gli3 C T 13: 15,613,850 H147Y probably damaging Het
Gm10754 G T 10: 97,682,227 probably benign Het
Gpr37 T C 6: 25,669,138 D569G probably damaging Het
Grina T A 15: 76,249,089 Y286N probably damaging Het
Gtf3c1 C A 7: 125,693,138 probably null Het
Kcnc4 C T 3: 107,448,218 V305M probably benign Het
Kntc1 T C 5: 123,778,275 F724L probably benign Het
Kpnb1 T C 11: 97,178,310 Y249C probably damaging Het
Krt6b T C 15: 101,678,374 T269A probably benign Het
Lamc1 T C 1: 153,221,634 K1555E probably damaging Het
Maneal T C 4: 124,861,857 Y104C probably damaging Het
Map1b T C 13: 99,431,171 T1681A unknown Het
Mettl17 T C 14: 51,890,703 L272P probably benign Het
Mib2 T A 4: 155,656,999 S357C probably benign Het
Mmp19 C A 10: 128,798,178 T316K possibly damaging Het
Mroh9 C T 1: 163,026,509 G774E probably damaging Het
Myh1 T C 11: 67,205,499 probably benign Het
Ncor2 C A 5: 125,027,138 E963* probably null Het
Nol6 T A 4: 41,123,596 T51S probably benign Het
Nsun3 A T 16: 62,735,369 C265S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Nutm2 T A 13: 50,469,481 N71K probably damaging Het
Olfr498 C T 7: 108,465,960 T212I probably benign Het
Olfr713 T G 7: 107,036,149 L5R probably benign Het
Orc3 T A 4: 34,607,228 E34V possibly damaging Het
Pcdhb13 T A 18: 37,442,836 L89Q probably damaging Het
Polr3a A T 14: 24,452,548 V1241E probably null Het
Prpf39 C T 12: 65,053,314 P135S probably damaging Het
Psrc1 T C 3: 108,384,993 V34A probably benign Het
Rab27a G A 9: 73,082,402 V52M probably benign Het
Rassf9 A G 10: 102,546,034 T424A probably benign Het
Ripor3 G T 2: 168,000,377 R61S possibly damaging Het
Ryr3 C T 2: 112,636,522 probably benign Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Setbp1 C T 18: 78,783,301 V1366M probably benign Het
Smad1 G A 8: 79,343,730 A393V probably benign Het
Tctn2 T C 5: 124,607,763 noncoding transcript Het
Tmem45a A T 16: 56,811,602 F218I possibly damaging Het
Tpte A T 8: 22,355,471 R512S probably damaging Het
Trim37 T A 11: 87,129,759 L22* probably null Het
Ttc6 A G 12: 57,737,130 N1792D probably damaging Het
Ttn A G 2: 76,945,616 M1694T probably damaging Het
Vmn1r181 T A 7: 23,984,712 W201R probably damaging Het
Wdr74 C T 19: 8,738,228 L198F possibly damaging Het
Zfp560 T C 9: 20,348,790 T259A probably benign Het
Other mutations in Fyb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fyb APN 15 6580777 missense probably damaging 0.99
IGL00801:Fyb APN 15 6644824 missense possibly damaging 0.86
IGL00974:Fyb APN 15 6642585 unclassified probably benign
IGL01377:Fyb APN 15 6580320 missense probably benign 0.01
IGL01982:Fyb APN 15 6580177 missense probably null 0.99
IGL02173:Fyb APN 15 6580695 missense probably benign 0.00
IGL02177:Fyb APN 15 6658566 critical splice donor site probably null
IGL02345:Fyb APN 15 6619662 missense possibly damaging 0.94
IGL02695:Fyb APN 15 6580921 missense probably damaging 1.00
IGL02820:Fyb APN 15 6658559 missense possibly damaging 0.65
IGL02867:Fyb APN 15 6580046 missense probably damaging 1.00
baddie UTSW 15 6652491 missense probably damaging 1.00
luegner UTSW 15 6580869 nonsense probably null
uebeltaeter UTSW 15 6638907 missense probably damaging 1.00
P0023:Fyb UTSW 15 6651854 missense probably damaging 1.00
R0028:Fyb UTSW 15 6644914 intron probably benign
R0364:Fyb UTSW 15 6580791 missense probably damaging 1.00
R0507:Fyb UTSW 15 6634816 missense probably benign 0.39
R0588:Fyb UTSW 15 6580459 missense probably benign 0.03
R0742:Fyb UTSW 15 6634816 missense probably benign 0.39
R0930:Fyb UTSW 15 6638828 missense probably damaging 1.00
R1184:Fyb UTSW 15 6638900 missense probably damaging 1.00
R1446:Fyb UTSW 15 6652466 missense probably benign 0.02
R1711:Fyb UTSW 15 6580479 missense probably damaging 1.00
R2041:Fyb UTSW 15 6644787 missense possibly damaging 0.78
R2176:Fyb UTSW 15 6579954 missense probably damaging 1.00
R2224:Fyb UTSW 15 6652383 missense probably damaging 1.00
R2372:Fyb UTSW 15 6651907 splice site probably benign
R3236:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4117:Fyb UTSW 15 6630116 missense probably damaging 0.96
R4181:Fyb UTSW 15 6580923 missense probably benign 0.00
R4322:Fyb UTSW 15 6580819 missense possibly damaging 0.84
R4952:Fyb UTSW 15 6638811 missense probably damaging 1.00
R4981:Fyb UTSW 15 6646611 splice site probably benign
R5055:Fyb UTSW 15 6585149 unclassified probably benign
R5368:Fyb UTSW 15 6580678 splice site probably null
R5719:Fyb UTSW 15 6580869 nonsense probably null
R5822:Fyb UTSW 15 6663226 unclassified probably benign
R6064:Fyb UTSW 15 6638868 missense probably damaging 1.00
R6929:Fyb UTSW 15 6638907 missense probably damaging 1.00
R7125:Fyb UTSW 15 6644856 missense possibly damaging 0.77
R7243:Fyb UTSW 15 6643699 missense probably benign 0.19
R7748:Fyb UTSW 15 6638826 missense probably damaging 1.00
R7750:Fyb UTSW 15 6660703 missense probably damaging 1.00
R7902:Fyb UTSW 15 6660716 critical splice donor site probably null
R8182:Fyb UTSW 15 6651812 missense probably benign
R8841:Fyb UTSW 15 6652491 missense probably damaging 1.00
R9103:Fyb UTSW 15 6643751 missense possibly damaging 0.66
R9256:Fyb UTSW 15 6644877 missense possibly damaging 0.61
R9385:Fyb UTSW 15 6634816 missense probably benign 0.39
Z1088:Fyb UTSW 15 6658540 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CTGGGGACAGGAGATGTGAATACTAGAT -3'
(R):5'- CCTGGCGAGACCCTGCTGA -3'

Sequencing Primer
(F):5'- GGAGATGTGAATACTAGATTTCTCTG -3'
(R):5'- AGACCCTGCTGATGAAATCG -3'
Posted On 2014-03-28