Incidental Mutation 'R1481:Setbp1'
ID 164412
Institutional Source Beutler Lab
Gene Symbol Setbp1
Ensembl Gene ENSMUSG00000024548
Gene Name SET binding protein 1
Synonyms Seb
MMRRC Submission 039534-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.596) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 78793595-79152606 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 78826516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 1366 (V1366M)
Ref Sequence ENSEMBL: ENSMUSP00000025430 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025430]
AlphaFold Q9Z180
Predicted Effect probably benign
Transcript: ENSMUST00000025430
AA Change: V1366M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000025430
Gene: ENSMUSG00000024548
AA Change: V1366M

DomainStartEndE-ValueType
low complexity region 155 165 N/A INTRINSIC
low complexity region 221 251 N/A INTRINSIC
low complexity region 278 286 N/A INTRINSIC
AT_hook 528 540 4.64e-1 SMART
low complexity region 565 571 N/A INTRINSIC
low complexity region 594 617 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
AT_hook 960 972 1.89e-1 SMART
low complexity region 1086 1103 N/A INTRINSIC
low complexity region 1316 1337 N/A INTRINSIC
AT_hook 1393 1405 7.27e-1 SMART
low complexity region 1462 1486 N/A INTRINSIC
low complexity region 1498 1514 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161465
AA Change: V1366M

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124497
Gene: ENSMUSG00000024548
AA Change: V1366M

DomainStartEndE-ValueType
low complexity region 46 55 N/A INTRINSIC
low complexity region 202 212 N/A INTRINSIC
low complexity region 268 298 N/A INTRINSIC
low complexity region 325 333 N/A INTRINSIC
AT_hook 575 587 4.64e-1 SMART
low complexity region 612 618 N/A INTRINSIC
low complexity region 641 664 N/A INTRINSIC
low complexity region 925 934 N/A INTRINSIC
AT_hook 1007 1019 1.89e-1 SMART
low complexity region 1133 1150 N/A INTRINSIC
low complexity region 1363 1384 N/A INTRINSIC
AT_hook 1440 1452 7.27e-1 SMART
low complexity region 1509 1533 N/A INTRINSIC
low complexity region 1545 1561 N/A INTRINSIC
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a several motifs including a ski homology region and a SET-binding region in addition to three nuclear localization signals. The encoded protein has been shown to bind the SET nuclear oncogene which is involved in DNA replication. Mutations in this gene are associated with Schinzel-Giedion midface retraction syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef5 A G 6: 43,251,568 (GRCm39) H773R probably damaging Het
Bltp1 T C 3: 37,062,583 (GRCm39) V3365A probably damaging Het
Bmp3 G A 5: 99,020,329 (GRCm39) V251M probably damaging Het
Ccdc175 C A 12: 72,148,722 (GRCm39) probably benign Het
Ccdc178 C T 18: 22,238,678 (GRCm39) G313D probably benign Het
Cd300ld2 T A 11: 114,903,459 (GRCm39) I129F probably benign Het
Cep170 T C 1: 176,609,951 (GRCm39) Q120R possibly damaging Het
Ckb T C 12: 111,637,696 (GRCm39) H145R probably benign Het
Cntnap5a T A 1: 116,045,393 (GRCm39) N336K probably damaging Het
Coil T A 11: 88,864,886 (GRCm39) C38S possibly damaging Het
Cps1 T C 1: 67,183,041 (GRCm39) V133A probably damaging Het
Cspg4 A G 9: 56,795,094 (GRCm39) E943G probably damaging Het
Cyp2c54 C T 19: 40,036,032 (GRCm39) D293N probably benign Het
Cyp2f2 T C 7: 26,821,302 (GRCm39) S72P probably benign Het
Dip2c G A 13: 9,601,902 (GRCm39) probably null Het
Dock6 T C 9: 21,731,918 (GRCm39) T1158A probably benign Het
Dscaml1 G A 9: 45,583,941 (GRCm39) V469I probably benign Het
Efcab14 A G 4: 115,613,714 (GRCm39) T221A probably benign Het
Ehbp1 T C 11: 21,956,782 (GRCm39) *1207W probably null Het
Eln T C 5: 134,735,426 (GRCm39) K786E probably damaging Het
Fyb1 C T 15: 6,649,128 (GRCm39) P385S probably benign Het
Galr1 A G 18: 82,423,866 (GRCm39) I137T possibly damaging Het
Gcm1 A T 9: 77,966,999 (GRCm39) K73* probably null Het
Gemin5 T C 11: 58,032,480 (GRCm39) N775D probably damaging Het
Gli3 C T 13: 15,788,435 (GRCm39) H147Y probably damaging Het
Gm10754 G T 10: 97,518,089 (GRCm39) probably benign Het
Gpr37 T C 6: 25,669,137 (GRCm39) D569G probably damaging Het
Grina T A 15: 76,133,289 (GRCm39) Y286N probably damaging Het
Gtf3c1 C A 7: 125,292,310 (GRCm39) probably null Het
Kcnc4 C T 3: 107,355,534 (GRCm39) V305M probably benign Het
Kntc1 T C 5: 123,916,338 (GRCm39) F724L probably benign Het
Kpnb1 T C 11: 97,069,136 (GRCm39) Y249C probably damaging Het
Krt6b T C 15: 101,586,809 (GRCm39) T269A probably benign Het
Lamc1 T C 1: 153,097,380 (GRCm39) K1555E probably damaging Het
Maneal T C 4: 124,755,650 (GRCm39) Y104C probably damaging Het
Map1b T C 13: 99,567,679 (GRCm39) T1681A unknown Het
Mettl17 T C 14: 52,128,160 (GRCm39) L272P probably benign Het
Mib2 T A 4: 155,741,456 (GRCm39) S357C probably benign Het
Mmp19 C A 10: 128,634,047 (GRCm39) T316K possibly damaging Het
Mroh9 C T 1: 162,854,078 (GRCm39) G774E probably damaging Het
Myh1 T C 11: 67,096,325 (GRCm39) probably benign Het
Ncor2 C A 5: 125,104,202 (GRCm39) E963* probably null Het
Nol6 T A 4: 41,123,596 (GRCm39) T51S probably benign Het
Nsun3 A T 16: 62,555,732 (GRCm39) C265S probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Nutm2 T A 13: 50,623,517 (GRCm39) N71K probably damaging Het
Or10a5 T G 7: 106,635,356 (GRCm39) L5R probably benign Het
Or5p73 C T 7: 108,065,167 (GRCm39) T212I probably benign Het
Orc3 T A 4: 34,607,228 (GRCm39) E34V possibly damaging Het
Pcdhb13 T A 18: 37,575,889 (GRCm39) L89Q probably damaging Het
Polr3a A T 14: 24,502,616 (GRCm39) V1241E probably null Het
Prpf39 C T 12: 65,100,088 (GRCm39) P135S probably damaging Het
Psrc1 T C 3: 108,292,309 (GRCm39) V34A probably benign Het
Rab27a G A 9: 72,989,684 (GRCm39) V52M probably benign Het
Rassf9 A G 10: 102,381,895 (GRCm39) T424A probably benign Het
Ripor3 G T 2: 167,842,297 (GRCm39) R61S possibly damaging Het
Ryr3 C T 2: 112,466,867 (GRCm39) probably benign Het
Samd4b C T 7: 28,113,435 (GRCm39) G177R probably damaging Het
Smad1 G A 8: 80,070,359 (GRCm39) A393V probably benign Het
Tctn2 T C 5: 124,745,826 (GRCm39) noncoding transcript Het
Tmem45a A T 16: 56,631,965 (GRCm39) F218I possibly damaging Het
Tpte A T 8: 22,845,487 (GRCm39) R512S probably damaging Het
Trim37 T A 11: 87,020,585 (GRCm39) L22* probably null Het
Ttc6 A G 12: 57,783,916 (GRCm39) N1792D probably damaging Het
Ttn A G 2: 76,775,960 (GRCm39) M1694T probably damaging Het
Vmn1r181 T A 7: 23,684,137 (GRCm39) W201R probably damaging Het
Wdr74 C T 19: 8,715,592 (GRCm39) L198F possibly damaging Het
Zfp560 T C 9: 20,260,086 (GRCm39) T259A probably benign Het
Other mutations in Setbp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Setbp1 APN 18 78,798,894 (GRCm39) nonsense probably null 0.00
IGL00668:Setbp1 APN 18 78,900,985 (GRCm39) missense probably damaging 1.00
IGL01628:Setbp1 APN 18 78,899,992 (GRCm39) missense probably damaging 1.00
IGL02084:Setbp1 APN 18 78,900,625 (GRCm39) missense probably damaging 1.00
IGL02405:Setbp1 APN 18 78,900,514 (GRCm39) missense probably damaging 1.00
IGL02427:Setbp1 APN 18 78,900,688 (GRCm39) missense probably damaging 1.00
IGL02612:Setbp1 APN 18 78,798,925 (GRCm39) missense probably damaging 1.00
IGL02725:Setbp1 APN 18 78,900,589 (GRCm39) nonsense probably null
IGL03005:Setbp1 APN 18 78,902,340 (GRCm39) missense possibly damaging 0.75
IGL03123:Setbp1 APN 18 78,900,224 (GRCm39) missense probably damaging 1.00
R1083:Setbp1 UTSW 18 78,900,841 (GRCm39) missense probably damaging 1.00
R1110:Setbp1 UTSW 18 78,901,075 (GRCm39) missense probably damaging 1.00
R1167:Setbp1 UTSW 18 78,900,451 (GRCm39) missense possibly damaging 0.85
R1221:Setbp1 UTSW 18 78,899,798 (GRCm39) missense probably damaging 1.00
R1225:Setbp1 UTSW 18 78,901,423 (GRCm39) missense probably damaging 0.99
R1327:Setbp1 UTSW 18 78,826,573 (GRCm39) missense probably benign 0.00
R1482:Setbp1 UTSW 18 79,130,050 (GRCm39) missense probably damaging 1.00
R1496:Setbp1 UTSW 18 78,903,127 (GRCm39) missense probably damaging 1.00
R1550:Setbp1 UTSW 18 78,901,807 (GRCm39) missense probably damaging 1.00
R1708:Setbp1 UTSW 18 78,901,682 (GRCm39) missense probably damaging 0.99
R1751:Setbp1 UTSW 18 78,900,613 (GRCm39) missense probably damaging 1.00
R1922:Setbp1 UTSW 18 78,901,577 (GRCm39) missense possibly damaging 0.75
R1986:Setbp1 UTSW 18 78,901,759 (GRCm39) missense probably damaging 0.99
R2090:Setbp1 UTSW 18 78,899,935 (GRCm39) missense probably benign 0.00
R2851:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2853:Setbp1 UTSW 18 78,967,211 (GRCm39) missense probably benign 0.11
R2941:Setbp1 UTSW 18 78,901,412 (GRCm39) missense probably damaging 1.00
R3151:Setbp1 UTSW 18 78,900,650 (GRCm39) missense probably damaging 1.00
R3156:Setbp1 UTSW 18 78,902,518 (GRCm39) missense probably benign 0.00
R3807:Setbp1 UTSW 18 78,826,537 (GRCm39) missense probably benign 0.01
R4133:Setbp1 UTSW 18 78,900,206 (GRCm39) missense probably benign 0.05
R4287:Setbp1 UTSW 18 78,902,276 (GRCm39) missense probably benign 0.03
R4345:Setbp1 UTSW 18 79,129,794 (GRCm39) missense probably damaging 0.99
R4374:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4377:Setbp1 UTSW 18 78,903,137 (GRCm39) missense probably damaging 0.97
R4378:Setbp1 UTSW 18 78,899,833 (GRCm39) missense possibly damaging 0.95
R4379:Setbp1 UTSW 18 79,129,896 (GRCm39) missense probably damaging 1.00
R4585:Setbp1 UTSW 18 79,130,164 (GRCm39) missense probably benign 0.00
R4595:Setbp1 UTSW 18 78,900,731 (GRCm39) missense probably benign 0.00
R4817:Setbp1 UTSW 18 78,902,015 (GRCm39) missense probably damaging 1.00
R4971:Setbp1 UTSW 18 78,901,382 (GRCm39) missense probably benign 0.07
R4976:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5017:Setbp1 UTSW 18 78,899,809 (GRCm39) missense possibly damaging 0.81
R5066:Setbp1 UTSW 18 78,900,514 (GRCm39) missense probably damaging 1.00
R5133:Setbp1 UTSW 18 78,900,697 (GRCm39) missense probably damaging 1.00
R5151:Setbp1 UTSW 18 78,901,214 (GRCm39) missense probably damaging 1.00
R5237:Setbp1 UTSW 18 78,900,190 (GRCm39) missense possibly damaging 0.92
R5480:Setbp1 UTSW 18 78,901,278 (GRCm39) missense probably damaging 0.99
R5507:Setbp1 UTSW 18 79,129,927 (GRCm39) missense probably damaging 1.00
R5529:Setbp1 UTSW 18 79,129,867 (GRCm39) missense probably damaging 0.99
R5622:Setbp1 UTSW 18 78,900,700 (GRCm39) missense probably damaging 1.00
R5722:Setbp1 UTSW 18 78,899,860 (GRCm39) missense possibly damaging 0.95
R5806:Setbp1 UTSW 18 78,899,697 (GRCm39) splice site probably null
R5940:Setbp1 UTSW 18 78,798,703 (GRCm39) missense probably damaging 1.00
R6025:Setbp1 UTSW 18 78,902,455 (GRCm39) missense probably damaging 0.98
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6030:Setbp1 UTSW 18 78,900,926 (GRCm39) missense probably benign 0.02
R6250:Setbp1 UTSW 18 78,901,217 (GRCm39) missense probably benign 0.00
R6256:Setbp1 UTSW 18 78,900,472 (GRCm39) missense probably damaging 1.00
R6332:Setbp1 UTSW 18 78,826,584 (GRCm39) missense probably benign 0.21
R6522:Setbp1 UTSW 18 78,900,605 (GRCm39) missense probably damaging 0.98
R6873:Setbp1 UTSW 18 78,902,774 (GRCm39) missense probably benign 0.00
R6886:Setbp1 UTSW 18 78,900,715 (GRCm39) missense probably damaging 1.00
R6986:Setbp1 UTSW 18 78,901,054 (GRCm39) missense probably damaging 1.00
R7042:Setbp1 UTSW 18 79,130,070 (GRCm39) missense probably damaging 1.00
R7131:Setbp1 UTSW 18 79,130,175 (GRCm39) missense probably benign 0.08
R7134:Setbp1 UTSW 18 78,902,734 (GRCm39) missense possibly damaging 0.86
R7215:Setbp1 UTSW 18 78,900,052 (GRCm39) missense probably damaging 0.97
R7219:Setbp1 UTSW 18 78,798,960 (GRCm39) missense probably damaging 1.00
R7378:Setbp1 UTSW 18 78,900,701 (GRCm39) missense probably damaging 1.00
R7461:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.06
R7589:Setbp1 UTSW 18 78,899,707 (GRCm39) missense probably benign 0.01
R7840:Setbp1 UTSW 18 78,826,639 (GRCm39) missense probably benign 0.03
R7849:Setbp1 UTSW 18 78,900,068 (GRCm39) missense probably benign 0.00
R8147:Setbp1 UTSW 18 78,900,015 (GRCm39) missense probably damaging 1.00
R8354:Setbp1 UTSW 18 78,900,598 (GRCm39) missense probably damaging 1.00
R8446:Setbp1 UTSW 18 78,900,971 (GRCm39) missense probably damaging 1.00
R8524:Setbp1 UTSW 18 78,901,969 (GRCm39) missense probably damaging 1.00
R8534:Setbp1 UTSW 18 78,826,542 (GRCm39) missense possibly damaging 0.86
R8694:Setbp1 UTSW 18 78,901,516 (GRCm39) missense probably damaging 1.00
R8931:Setbp1 UTSW 18 78,899,723 (GRCm39) missense probably benign 0.00
R8983:Setbp1 UTSW 18 78,902,459 (GRCm39) missense probably benign 0.37
R9062:Setbp1 UTSW 18 78,900,266 (GRCm39) missense probably benign 0.01
R9113:Setbp1 UTSW 18 78,900,948 (GRCm39) missense probably damaging 0.99
R9364:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9513:Setbp1 UTSW 18 78,899,781 (GRCm39) missense probably damaging 1.00
R9517:Setbp1 UTSW 18 78,901,322 (GRCm39) missense probably damaging 0.99
R9549:Setbp1 UTSW 18 78,902,629 (GRCm39) missense probably benign 0.07
R9554:Setbp1 UTSW 18 78,826,599 (GRCm39) missense probably benign 0.00
R9680:Setbp1 UTSW 18 78,902,498 (GRCm39) missense probably benign
R9711:Setbp1 UTSW 18 78,900,142 (GRCm39) missense probably benign 0.30
Z1088:Setbp1 UTSW 18 78,902,809 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAGAACCTGGTCCTTGCTGTTACG -3'
(R):5'- TCAACTTGCTGCACTGGAAGGAG -3'

Sequencing Primer
(F):5'- caatccttgtgtctccaccc -3'
(R):5'- GAGGACAAACAGTTGGACTATTTAC -3'
Posted On 2014-03-28