Incidental Mutation 'R1481:Cyp2c54'
ID 164415
Institutional Source Beutler Lab
Gene Symbol Cyp2c54
Ensembl Gene ENSMUSG00000067225
Gene Name cytochrome P450, family 2, subfamily c, polypeptide 54
Synonyms
MMRRC Submission 039534-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.125) question?
Stock # R1481 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 40026384-40062271 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 40036032 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 293 (D293N)
Ref Sequence ENSEMBL: ENSMUSP00000048284 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048959]
AlphaFold Q6XVG2
Predicted Effect probably benign
Transcript: ENSMUST00000048959
AA Change: D293N

PolyPhen 2 Score 0.304 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048284
Gene: ENSMUSG00000067225
AA Change: D293N

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:p450 30 487 2.2e-159 PFAM
Meta Mutation Damage Score 0.3843 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.6%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef5 A G 6: 43,251,568 (GRCm39) H773R probably damaging Het
Bltp1 T C 3: 37,062,583 (GRCm39) V3365A probably damaging Het
Bmp3 G A 5: 99,020,329 (GRCm39) V251M probably damaging Het
Ccdc175 C A 12: 72,148,722 (GRCm39) probably benign Het
Ccdc178 C T 18: 22,238,678 (GRCm39) G313D probably benign Het
Cd300ld2 T A 11: 114,903,459 (GRCm39) I129F probably benign Het
Cep170 T C 1: 176,609,951 (GRCm39) Q120R possibly damaging Het
Ckb T C 12: 111,637,696 (GRCm39) H145R probably benign Het
Cntnap5a T A 1: 116,045,393 (GRCm39) N336K probably damaging Het
Coil T A 11: 88,864,886 (GRCm39) C38S possibly damaging Het
Cps1 T C 1: 67,183,041 (GRCm39) V133A probably damaging Het
Cspg4 A G 9: 56,795,094 (GRCm39) E943G probably damaging Het
Cyp2f2 T C 7: 26,821,302 (GRCm39) S72P probably benign Het
Dip2c G A 13: 9,601,902 (GRCm39) probably null Het
Dock6 T C 9: 21,731,918 (GRCm39) T1158A probably benign Het
Dscaml1 G A 9: 45,583,941 (GRCm39) V469I probably benign Het
Efcab14 A G 4: 115,613,714 (GRCm39) T221A probably benign Het
Ehbp1 T C 11: 21,956,782 (GRCm39) *1207W probably null Het
Eln T C 5: 134,735,426 (GRCm39) K786E probably damaging Het
Fyb1 C T 15: 6,649,128 (GRCm39) P385S probably benign Het
Galr1 A G 18: 82,423,866 (GRCm39) I137T possibly damaging Het
Gcm1 A T 9: 77,966,999 (GRCm39) K73* probably null Het
Gemin5 T C 11: 58,032,480 (GRCm39) N775D probably damaging Het
Gli3 C T 13: 15,788,435 (GRCm39) H147Y probably damaging Het
Gm10754 G T 10: 97,518,089 (GRCm39) probably benign Het
Gpr37 T C 6: 25,669,137 (GRCm39) D569G probably damaging Het
Grina T A 15: 76,133,289 (GRCm39) Y286N probably damaging Het
Gtf3c1 C A 7: 125,292,310 (GRCm39) probably null Het
Kcnc4 C T 3: 107,355,534 (GRCm39) V305M probably benign Het
Kntc1 T C 5: 123,916,338 (GRCm39) F724L probably benign Het
Kpnb1 T C 11: 97,069,136 (GRCm39) Y249C probably damaging Het
Krt6b T C 15: 101,586,809 (GRCm39) T269A probably benign Het
Lamc1 T C 1: 153,097,380 (GRCm39) K1555E probably damaging Het
Maneal T C 4: 124,755,650 (GRCm39) Y104C probably damaging Het
Map1b T C 13: 99,567,679 (GRCm39) T1681A unknown Het
Mettl17 T C 14: 52,128,160 (GRCm39) L272P probably benign Het
Mib2 T A 4: 155,741,456 (GRCm39) S357C probably benign Het
Mmp19 C A 10: 128,634,047 (GRCm39) T316K possibly damaging Het
Mroh9 C T 1: 162,854,078 (GRCm39) G774E probably damaging Het
Myh1 T C 11: 67,096,325 (GRCm39) probably benign Het
Ncor2 C A 5: 125,104,202 (GRCm39) E963* probably null Het
Nol6 T A 4: 41,123,596 (GRCm39) T51S probably benign Het
Nsun3 A T 16: 62,555,732 (GRCm39) C265S probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Nutm2 T A 13: 50,623,517 (GRCm39) N71K probably damaging Het
Or10a5 T G 7: 106,635,356 (GRCm39) L5R probably benign Het
Or5p73 C T 7: 108,065,167 (GRCm39) T212I probably benign Het
Orc3 T A 4: 34,607,228 (GRCm39) E34V possibly damaging Het
Pcdhb13 T A 18: 37,575,889 (GRCm39) L89Q probably damaging Het
Polr3a A T 14: 24,502,616 (GRCm39) V1241E probably null Het
Prpf39 C T 12: 65,100,088 (GRCm39) P135S probably damaging Het
Psrc1 T C 3: 108,292,309 (GRCm39) V34A probably benign Het
Rab27a G A 9: 72,989,684 (GRCm39) V52M probably benign Het
Rassf9 A G 10: 102,381,895 (GRCm39) T424A probably benign Het
Ripor3 G T 2: 167,842,297 (GRCm39) R61S possibly damaging Het
Ryr3 C T 2: 112,466,867 (GRCm39) probably benign Het
Samd4b C T 7: 28,113,435 (GRCm39) G177R probably damaging Het
Setbp1 C T 18: 78,826,516 (GRCm39) V1366M probably benign Het
Smad1 G A 8: 80,070,359 (GRCm39) A393V probably benign Het
Tctn2 T C 5: 124,745,826 (GRCm39) noncoding transcript Het
Tmem45a A T 16: 56,631,965 (GRCm39) F218I possibly damaging Het
Tpte A T 8: 22,845,487 (GRCm39) R512S probably damaging Het
Trim37 T A 11: 87,020,585 (GRCm39) L22* probably null Het
Ttc6 A G 12: 57,783,916 (GRCm39) N1792D probably damaging Het
Ttn A G 2: 76,775,960 (GRCm39) M1694T probably damaging Het
Vmn1r181 T A 7: 23,684,137 (GRCm39) W201R probably damaging Het
Wdr74 C T 19: 8,715,592 (GRCm39) L198F possibly damaging Het
Zfp560 T C 9: 20,260,086 (GRCm39) T259A probably benign Het
Other mutations in Cyp2c54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Cyp2c54 APN 19 40,060,522 (GRCm39) missense probably damaging 1.00
IGL02694:Cyp2c54 APN 19 40,035,987 (GRCm39) missense possibly damaging 0.55
IGL03170:Cyp2c54 APN 19 40,060,809 (GRCm39) critical splice donor site probably null
IGL03175:Cyp2c54 APN 19 40,058,672 (GRCm39) missense probably benign 0.00
R0097:Cyp2c54 UTSW 19 40,036,103 (GRCm39) splice site probably benign
R0097:Cyp2c54 UTSW 19 40,036,102 (GRCm39) splice site probably benign
R0391:Cyp2c54 UTSW 19 40,060,613 (GRCm39) missense possibly damaging 0.61
R0581:Cyp2c54 UTSW 19 40,035,999 (GRCm39) missense probably benign 0.23
R0787:Cyp2c54 UTSW 19 40,036,079 (GRCm39) missense probably benign 0.12
R1253:Cyp2c54 UTSW 19 40,034,629 (GRCm39) missense probably damaging 1.00
R1604:Cyp2c54 UTSW 19 40,058,787 (GRCm39) missense probably benign 0.01
R3624:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R3871:Cyp2c54 UTSW 19 40,060,867 (GRCm39) missense probably benign 0.37
R3983:Cyp2c54 UTSW 19 40,034,699 (GRCm39) missense possibly damaging 0.49
R4401:Cyp2c54 UTSW 19 40,060,615 (GRCm39) missense probably benign 0.04
R4416:Cyp2c54 UTSW 19 40,026,703 (GRCm39) missense probably benign 0.04
R4962:Cyp2c54 UTSW 19 40,060,585 (GRCm39) missense possibly damaging 0.90
R5203:Cyp2c54 UTSW 19 40,060,918 (GRCm39) missense probably damaging 1.00
R5634:Cyp2c54 UTSW 19 40,060,858 (GRCm39) missense possibly damaging 0.84
R6083:Cyp2c54 UTSW 19 40,062,206 (GRCm39) missense probably benign 0.20
R6182:Cyp2c54 UTSW 19 40,036,005 (GRCm39) missense probably benign
R6754:Cyp2c54 UTSW 19 40,060,004 (GRCm39) missense probably damaging 1.00
R6901:Cyp2c54 UTSW 19 40,058,703 (GRCm39) missense probably damaging 1.00
R6948:Cyp2c54 UTSW 19 40,034,636 (GRCm39) missense possibly damaging 0.73
R7215:Cyp2c54 UTSW 19 40,034,626 (GRCm39) missense probably damaging 1.00
R7244:Cyp2c54 UTSW 19 40,035,953 (GRCm39) missense probably damaging 1.00
R7278:Cyp2c54 UTSW 19 40,058,697 (GRCm39) nonsense probably null
R7535:Cyp2c54 UTSW 19 40,058,716 (GRCm39) missense probably benign
R7838:Cyp2c54 UTSW 19 40,058,688 (GRCm39) missense probably benign 0.21
R8039:Cyp2c54 UTSW 19 40,062,176 (GRCm39) frame shift probably null
R8275:Cyp2c54 UTSW 19 40,026,749 (GRCm39) missense probably benign 0.00
R8340:Cyp2c54 UTSW 19 40,060,831 (GRCm39) missense possibly damaging 0.94
R8367:Cyp2c54 UTSW 19 40,062,125 (GRCm39) missense probably damaging 0.99
R8477:Cyp2c54 UTSW 19 40,058,708 (GRCm39) missense probably benign 0.43
R8487:Cyp2c54 UTSW 19 40,059,990 (GRCm39) missense probably damaging 1.00
R8519:Cyp2c54 UTSW 19 40,026,857 (GRCm39) missense probably damaging 0.99
R8534:Cyp2c54 UTSW 19 40,036,030 (GRCm39) missense probably damaging 0.99
R8858:Cyp2c54 UTSW 19 40,062,227 (GRCm39) missense probably benign 0.00
R9215:Cyp2c54 UTSW 19 40,035,950 (GRCm39) missense possibly damaging 0.52
R9236:Cyp2c54 UTSW 19 40,060,938 (GRCm39) nonsense probably null
R9470:Cyp2c54 UTSW 19 40,060,888 (GRCm39) missense probably damaging 1.00
R9792:Cyp2c54 UTSW 19 40,034,525 (GRCm39) missense probably damaging 1.00
Z1176:Cyp2c54 UTSW 19 40,034,659 (GRCm39) missense probably damaging 1.00
Z1177:Cyp2c54 UTSW 19 40,062,201 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGTCACCCTCCTCATTACAGACAGTG -3'
(R):5'- ACACACCTGGGCAGATAATCTTTGG -3'

Sequencing Primer
(F):5'- TCCTCATTACAGACAGTGAAACAG -3'
(R):5'- TCATTCTTAGGAAGATGACAATCATC -3'
Posted On 2014-03-28