Incidental Mutation 'R1482:Pard3b'
ID 164416
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Name par-3 family cell polarity regulator beta
Synonyms PAR3beta, 1810008K04Rik, 2810455B10Rik, PAR3B, 2010002N16Rik, Als2cr19, PAR3L
MMRRC Submission 039535-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1482 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 61638824-62642284 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62166367 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 440 (D440V)
Ref Sequence ENSEMBL: ENSMUSP00000092510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
AlphaFold Q9CSB4
Predicted Effect possibly damaging
Transcript: ENSMUST00000046673
AA Change: D440V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: D440V

Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075374
AA Change: D440V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: D440V

Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094906
AA Change: D440V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: D440V

Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188325
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Ankef1 A T 2: 136,550,158 K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aqp6 A T 15: 99,604,307 *294C probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Bcl2l14 A G 6: 134,427,302 D151G probably damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Clhc1 A G 11: 29,553,725 D47G probably damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Fth1 A G 19: 9,984,853 T154A probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nepn A T 10: 52,400,416 T22S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pou3f2 T G 4: 22,486,960 D391A possibly damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62161198 missense probably damaging 0.99
IGL01363:Pard3b APN 1 62637640 missense probably damaging 1.00
IGL01509:Pard3b APN 1 62161248 missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62637862 missense probably damaging 0.96
IGL01651:Pard3b APN 1 62479804 intron probably benign
IGL01670:Pard3b APN 1 62211648 missense probably damaging 1.00
IGL02156:Pard3b APN 1 61767950 missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62166382 missense probably damaging 1.00
IGL02450:Pard3b APN 1 62532676 missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62198771 splice site probably benign
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0040:Pard3b UTSW 1 62637820 missense probably damaging 1.00
R0060:Pard3b UTSW 1 61639315 missense probably damaging 0.97
R0157:Pard3b UTSW 1 62211633 missense probably damaging 0.96
R0333:Pard3b UTSW 1 62230212 missense probably benign 0.00
R0448:Pard3b UTSW 1 62166469 missense probably damaging 1.00
R0465:Pard3b UTSW 1 62211718 splice site probably benign
R0497:Pard3b UTSW 1 62440008 splice site probably null
R1264:Pard3b UTSW 1 62164157 missense probably damaging 1.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1468:Pard3b UTSW 1 62345029 missense probably benign 0.00
R1554:Pard3b UTSW 1 62637894 missense probably damaging 0.97
R1836:Pard3b UTSW 1 62637604 missense probably benign 0.03
R2005:Pard3b UTSW 1 62144891 missense probably benign 0.12
R2220:Pard3b UTSW 1 62479683 nonsense probably null
R2435:Pard3b UTSW 1 62587738 missense probably damaging 1.00
R3015:Pard3b UTSW 1 62344878 missense probably damaging 1.00
R3688:Pard3b UTSW 1 62479569 missense probably benign
R3712:Pard3b UTSW 1 62343978 missense probably damaging 1.00
R3799:Pard3b UTSW 1 62161229 missense probably benign 0.06
R3942:Pard3b UTSW 1 62159452 missense probably damaging 1.00
R4683:Pard3b UTSW 1 62216516 missense probably benign
R4729:Pard3b UTSW 1 62211684 missense probably damaging 1.00
R4898:Pard3b UTSW 1 61768000 missense probably damaging 1.00
R4981:Pard3b UTSW 1 62344060 missense probably damaging 1.00
R5049:Pard3b UTSW 1 62161161 missense probably benign 0.01
R5223:Pard3b UTSW 1 62344113 missense probably damaging 1.00
R5476:Pard3b UTSW 1 62010406 missense probably benign 0.10
R5541:Pard3b UTSW 1 61639343 missense probably damaging 1.00
R5672:Pard3b UTSW 1 62010466 missense probably benign 0.11
R5714:Pard3b UTSW 1 62637916 missense probably null 0.99
R5722:Pard3b UTSW 1 62440001 splice site probably null
R5793:Pard3b UTSW 1 61767973 missense probably damaging 1.00
R5930:Pard3b UTSW 1 61768130 intron probably benign
R5950:Pard3b UTSW 1 62216531 missense probably benign 0.04
R5997:Pard3b UTSW 1 62076409 missense probably damaging 1.00
R6646:Pard3b UTSW 1 62161121 missense probably benign 0.32
R6720:Pard3b UTSW 1 62159470 missense probably damaging 0.99
R6809:Pard3b UTSW 1 62161181 missense probably damaging 1.00
R7148:Pard3b UTSW 1 62440032 missense probably benign 0.01
R7847:Pard3b UTSW 1 62343934 missense probably benign 0.00
R7879:Pard3b UTSW 1 62159511 missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62153989 missense probably damaging 1.00
R8125:Pard3b UTSW 1 61767984 missense probably damaging 1.00
R8329:Pard3b UTSW 1 62637798 missense probably benign 0.30
R8766:Pard3b UTSW 1 62159478 missense probably benign 0.35
R8833:Pard3b UTSW 1 62344999 missense probably benign 0.00
R8889:Pard3b UTSW 1 62637867 missense probably damaging 0.97
R8892:Pard3b UTSW 1 62637867 missense probably damaging 0.97
R8907:Pard3b UTSW 1 62344135 missense probably benign 0.39
R8909:Pard3b UTSW 1 62344135 missense probably benign 0.39
R9215:Pard3b UTSW 1 62164185 missense probably damaging 1.00
R9310:Pard3b UTSW 1 62166369 missense probably damaging 0.99
R9542:Pard3b UTSW 1 62211627 nonsense probably null
Z1176:Pard3b UTSW 1 62238892 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- catgtttaccataccagcactc -3'
Posted On 2014-03-28