Incidental Mutation 'R1482:Pard3b'
ID 164416
Institutional Source Beutler Lab
Gene Symbol Pard3b
Ensembl Gene ENSMUSG00000052062
Gene Name par-3 family cell polarity regulator beta
Synonyms PAR3L, PAR3B, 1810008K04Rik, 2010002N16Rik, PAR3beta, Als2cr19, 2810455B10Rik
MMRRC Submission 039535-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1482 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 61677983-62681443 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62205526 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 440 (D440V)
Ref Sequence ENSEMBL: ENSMUSP00000092510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046673] [ENSMUST00000075374] [ENSMUST00000094906]
AlphaFold Q9CSB4
Predicted Effect possibly damaging
Transcript: ENSMUST00000046673
AA Change: D440V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040439
Gene: ENSMUSG00000052062
AA Change: D440V

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
internal_repeat_1 479 515 4.63e-5 PROSPERO
low complexity region 527 537 N/A INTRINSIC
low complexity region 594 601 N/A INTRINSIC
low complexity region 677 688 N/A INTRINSIC
coiled coil region 761 808 N/A INTRINSIC
coiled coil region 839 866 N/A INTRINSIC
low complexity region 1075 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075374
AA Change: D440V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074837
Gene: ENSMUSG00000052062
AA Change: D440V

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 8.2e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
coiled coil region 901 928 N/A INTRINSIC
low complexity region 1137 1145 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094906
AA Change: D440V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092510
Gene: ENSMUSG00000052062
AA Change: D440V

DomainStartEndE-ValueType
Pfam:DUF3534 1 143 1.1e-66 PFAM
PDZ 211 291 1.5e-4 SMART
low complexity region 376 388 N/A INTRINSIC
PDZ 391 470 2.5e-24 SMART
low complexity region 487 498 N/A INTRINSIC
PDZ 507 592 6.17e-15 SMART
low complexity region 656 663 N/A INTRINSIC
low complexity region 739 750 N/A INTRINSIC
coiled coil region 823 870 N/A INTRINSIC
low complexity region 901 913 N/A INTRINSIC
low complexity region 1038 1046 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188325
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,767,192 (GRCm39) D260N probably benign Het
Ankef1 A T 2: 136,392,078 (GRCm39) K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Aqp6 A T 15: 99,502,188 (GRCm39) *294C probably null Het
Baz2a T A 10: 127,944,877 (GRCm39) M38K possibly damaging Het
Bcl2l14 A G 6: 134,404,265 (GRCm39) D151G probably damaging Het
Cabp5 T A 7: 13,132,267 (GRCm39) L12* probably null Het
Cachd1 T C 4: 100,845,795 (GRCm39) V993A possibly damaging Het
Cd44 G A 2: 102,661,728 (GRCm39) T306I probably damaging Het
Cdc20 A T 4: 118,294,253 (GRCm39) N22K probably benign Het
Cdc6 T A 11: 98,807,807 (GRCm39) D433E possibly damaging Het
Clhc1 A G 11: 29,503,725 (GRCm39) D47G probably damaging Het
Csf2 T C 11: 54,139,389 (GRCm39) K65E probably benign Het
Cul9 T C 17: 46,819,473 (GRCm39) E2005G probably damaging Het
Dclk3 G T 9: 111,296,888 (GRCm39) R144L possibly damaging Het
Dcpp2 C T 17: 24,119,516 (GRCm39) T110I probably damaging Het
Disp1 A T 1: 182,868,038 (GRCm39) F1461I possibly damaging Het
Dnah1 C T 14: 31,016,831 (GRCm39) G1562D probably damaging Het
Ecpas T C 4: 58,820,163 (GRCm39) K1217E possibly damaging Het
Exoc3l2 C A 7: 19,229,284 (GRCm39) P234Q probably damaging Het
F2rl2 T C 13: 95,838,047 (GRCm39) V364A probably benign Het
Fam151a T C 4: 106,602,876 (GRCm39) L265P probably damaging Het
Fam151b T A 13: 92,586,674 (GRCm39) Q253L probably benign Het
Fat1 G A 8: 45,406,281 (GRCm39) V1011M probably benign Het
Fbxo6 G A 4: 148,230,441 (GRCm39) R274* probably null Het
Fgd4 G T 16: 16,302,337 (GRCm39) Q73K probably benign Het
Fth1 A G 19: 9,962,217 (GRCm39) T154A probably benign Het
Hgs C A 11: 120,370,866 (GRCm39) H572Q probably benign Het
Kcnk10 G A 12: 98,456,207 (GRCm39) T208I probably damaging Het
Kdm5b G A 1: 134,552,635 (GRCm39) V1204M probably damaging Het
Keg1 A C 19: 12,696,185 (GRCm39) H166P probably damaging Het
Kifap3 A T 1: 163,653,428 (GRCm39) N338I possibly damaging Het
Llcfc1 A T 6: 41,662,218 (GRCm39) D74V probably damaging Het
Lman2 A G 13: 55,499,218 (GRCm39) V219A possibly damaging Het
Mettl25 A G 10: 105,662,451 (GRCm39) I173T possibly damaging Het
Mov10 G T 3: 104,711,862 (GRCm39) P170Q probably damaging Het
Mtif2 G T 11: 29,486,847 (GRCm39) A286S probably damaging Het
Mtmr10 A G 7: 63,963,997 (GRCm39) Y244C probably damaging Het
Nbea A T 3: 55,987,414 (GRCm39) C359S probably damaging Het
Nbr1 C T 11: 101,463,667 (GRCm39) T633I probably benign Het
Nepn A T 10: 52,276,512 (GRCm39) T22S probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Oacyl T A 18: 65,871,043 (GRCm39) L342M probably damaging Het
Or2ag17 A G 7: 106,389,540 (GRCm39) F223L probably benign Het
Or52b2 T A 7: 104,986,463 (GRCm39) R153S probably damaging Het
Or6c205 T A 10: 129,087,012 (GRCm39) I203N possibly damaging Het
Or7e176 G A 9: 20,172,020 (GRCm39) V295I possibly damaging Het
Oxnad1 T C 14: 31,821,590 (GRCm39) probably null Het
Pou3f2 T G 4: 22,486,960 (GRCm39) D391A possibly damaging Het
Ptprk T C 10: 28,139,512 (GRCm39) V79A probably benign Het
Rwdd2a A G 9: 86,456,331 (GRCm39) D169G probably damaging Het
Scn3b A C 9: 40,190,792 (GRCm39) D74A probably damaging Het
Setbp1 C T 18: 79,130,050 (GRCm39) D61N probably damaging Het
Setx T A 2: 29,053,004 (GRCm39) D2089E probably damaging Het
Vmn2r69 C G 7: 85,056,082 (GRCm39) W685C probably damaging Het
Vps8 A G 16: 21,400,348 (GRCm39) Q1272R probably benign Het
Wnk4 T C 11: 101,160,462 (GRCm39) F699L probably damaging Het
Zfp616 T A 11: 73,974,803 (GRCm39) N448K possibly damaging Het
Zfp618 C A 4: 63,033,685 (GRCm39) D307E possibly damaging Het
Zfp687 A G 3: 94,914,844 (GRCm39) F1219S probably damaging Het
Zfpm2 T A 15: 40,962,687 (GRCm39) D248E probably damaging Het
Other mutations in Pard3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Pard3b APN 1 62,200,357 (GRCm39) missense probably damaging 0.99
IGL01363:Pard3b APN 1 62,676,799 (GRCm39) missense probably damaging 1.00
IGL01509:Pard3b APN 1 62,200,407 (GRCm39) missense possibly damaging 0.54
IGL01611:Pard3b APN 1 62,677,021 (GRCm39) missense probably damaging 0.96
IGL01651:Pard3b APN 1 62,518,963 (GRCm39) intron probably benign
IGL01670:Pard3b APN 1 62,250,807 (GRCm39) missense probably damaging 1.00
IGL02156:Pard3b APN 1 61,807,109 (GRCm39) missense possibly damaging 0.84
IGL02232:Pard3b APN 1 62,205,541 (GRCm39) missense probably damaging 1.00
IGL02450:Pard3b APN 1 62,571,835 (GRCm39) missense possibly damaging 0.68
IGL03064:Pard3b APN 1 62,237,930 (GRCm39) splice site probably benign
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0040:Pard3b UTSW 1 62,676,979 (GRCm39) missense probably damaging 1.00
R0060:Pard3b UTSW 1 61,678,474 (GRCm39) missense probably damaging 0.97
R0157:Pard3b UTSW 1 62,250,792 (GRCm39) missense probably damaging 0.96
R0333:Pard3b UTSW 1 62,269,371 (GRCm39) missense probably benign 0.00
R0448:Pard3b UTSW 1 62,205,628 (GRCm39) missense probably damaging 1.00
R0465:Pard3b UTSW 1 62,250,877 (GRCm39) splice site probably benign
R0497:Pard3b UTSW 1 62,479,167 (GRCm39) splice site probably null
R1264:Pard3b UTSW 1 62,203,316 (GRCm39) missense probably damaging 1.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1468:Pard3b UTSW 1 62,384,188 (GRCm39) missense probably benign 0.00
R1554:Pard3b UTSW 1 62,677,053 (GRCm39) missense probably damaging 0.97
R1836:Pard3b UTSW 1 62,676,763 (GRCm39) missense probably benign 0.03
R2005:Pard3b UTSW 1 62,184,050 (GRCm39) missense probably benign 0.12
R2220:Pard3b UTSW 1 62,518,842 (GRCm39) nonsense probably null
R2435:Pard3b UTSW 1 62,626,897 (GRCm39) missense probably damaging 1.00
R3015:Pard3b UTSW 1 62,384,037 (GRCm39) missense probably damaging 1.00
R3688:Pard3b UTSW 1 62,518,728 (GRCm39) missense probably benign
R3712:Pard3b UTSW 1 62,383,137 (GRCm39) missense probably damaging 1.00
R3799:Pard3b UTSW 1 62,200,388 (GRCm39) missense probably benign 0.06
R3942:Pard3b UTSW 1 62,198,611 (GRCm39) missense probably damaging 1.00
R4683:Pard3b UTSW 1 62,255,675 (GRCm39) missense probably benign
R4729:Pard3b UTSW 1 62,250,843 (GRCm39) missense probably damaging 1.00
R4898:Pard3b UTSW 1 61,807,159 (GRCm39) missense probably damaging 1.00
R4981:Pard3b UTSW 1 62,383,219 (GRCm39) missense probably damaging 1.00
R5049:Pard3b UTSW 1 62,200,320 (GRCm39) missense probably benign 0.01
R5223:Pard3b UTSW 1 62,383,272 (GRCm39) missense probably damaging 1.00
R5476:Pard3b UTSW 1 62,049,565 (GRCm39) missense probably benign 0.10
R5541:Pard3b UTSW 1 61,678,502 (GRCm39) missense probably damaging 1.00
R5672:Pard3b UTSW 1 62,049,625 (GRCm39) missense probably benign 0.11
R5714:Pard3b UTSW 1 62,677,075 (GRCm39) missense probably null 0.99
R5722:Pard3b UTSW 1 62,479,160 (GRCm39) splice site probably null
R5793:Pard3b UTSW 1 61,807,132 (GRCm39) missense probably damaging 1.00
R5930:Pard3b UTSW 1 61,807,289 (GRCm39) intron probably benign
R5950:Pard3b UTSW 1 62,255,690 (GRCm39) missense probably benign 0.04
R5997:Pard3b UTSW 1 62,115,568 (GRCm39) missense probably damaging 1.00
R6646:Pard3b UTSW 1 62,200,280 (GRCm39) missense probably benign 0.32
R6720:Pard3b UTSW 1 62,198,629 (GRCm39) missense probably damaging 0.99
R6809:Pard3b UTSW 1 62,200,340 (GRCm39) missense probably damaging 1.00
R7148:Pard3b UTSW 1 62,479,191 (GRCm39) missense probably benign 0.01
R7847:Pard3b UTSW 1 62,383,093 (GRCm39) missense probably benign 0.00
R7879:Pard3b UTSW 1 62,198,670 (GRCm39) missense possibly damaging 0.65
R8048:Pard3b UTSW 1 62,193,148 (GRCm39) missense probably damaging 1.00
R8125:Pard3b UTSW 1 61,807,143 (GRCm39) missense probably damaging 1.00
R8329:Pard3b UTSW 1 62,676,957 (GRCm39) missense probably benign 0.30
R8766:Pard3b UTSW 1 62,198,637 (GRCm39) missense probably benign 0.35
R8833:Pard3b UTSW 1 62,384,158 (GRCm39) missense probably benign 0.00
R8889:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8892:Pard3b UTSW 1 62,677,026 (GRCm39) missense probably damaging 0.97
R8907:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R8909:Pard3b UTSW 1 62,383,294 (GRCm39) missense probably benign 0.39
R9215:Pard3b UTSW 1 62,203,344 (GRCm39) missense probably damaging 1.00
R9310:Pard3b UTSW 1 62,205,528 (GRCm39) missense probably damaging 0.99
R9542:Pard3b UTSW 1 62,250,786 (GRCm39) nonsense probably null
Z1176:Pard3b UTSW 1 62,278,051 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCACACTTAATCCACAACATAGGTCGT -3'
(R):5'- GTGGGAATGCCACAAACATCACAC -3'

Sequencing Primer
(F):5'- catgtttaccataccagcactc -3'
(R):5'- GCCACAAACATCACACACAGAG -3'
Posted On 2014-03-28