Mutagenetix > Incidental Mutations

Incidental Mutation 'R1482:Kifap3'

164419

Institutional Source

Beutler Lab

Gene Symbol

Kifap3

Ensembl Gene

ENSMUSG00000026585

Gene Name

kinesin-associated protein 3

Synonyms

Smg GDS, KAP3

MMRRC Submission

039535-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1482 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

163779583-163917109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 163825859 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 338 (N338I)

Ref Sequence

ENSEMBL: ENSMUSP00000076830 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027877] [ENSMUST00000077642]

AlphaFold

P70188

Predicted Effect

probably damaging
Transcript: ENSMUST00000027877
AA Change: N338I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000027877
Gene: ENSMUSG00000026585
AA Change: N338I

Domain	Start	End	E-Value	Type
KAP	13	720	N/A	SMART
ARM	333	373	1.21e-3	SMART
ARM	374	412	9.68e0	SMART
ARM	578	620	1.28e-2	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000077642
AA Change: N338I

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000076830
Gene: ENSMUSG00000026585
AA Change: N338I

Domain	Start	End	E-Value	Type
KAP	13	720	N/A	SMART
ARM	333	373	1.21e-3	SMART
ARM	374	412	9.68e0	SMART
ARM	578	620	1.28e-2	SMART

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 83.6%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is the non-motor subunit of kinesin-2 complex, and forms a heterotrimer with two members of the kinesin superfamily of proteins that together form a microtubule plus-end directed translocator that plays an important role in intracellular transport, mitosis, and cell-cell adhesion. This protein contains multiple armadillo repeats involved in protein binding, and may serve as an adaptor to regulate binding of cargo with the motor proteins. Conditional disruption of this gene in mouse neural precursor cells caused a tumor-like phenotype and defective organization of the neuroepithelium thought to be the result of altered N-cadherin subcellular localization. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015]
PHENOTYPE: About 70% of homozygotes for a knock-out mutation die of heart failure shortly after birth due to massive cardiomyocyte apoptosis triggered by cardiovascular overload. Neonatal thymocytes and developing neuronal cells undergo apoptosis while cultured thymocytes are susceptible to apoptotic inducers. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	G	A	19: 3,717,192	D260N	probably benign	Het
AI314180	T	C	4: 58,820,163	K1217E	possibly damaging	Het
Ankef1	A	T	2: 136,550,158	K422N	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Aqp6	A	T	15: 99,604,307	*294C	probably null	Het
Baz2a	T	A	10: 128,109,008	M38K	possibly damaging	Het
Bcl2l14	A	G	6: 134,427,302	D151G	probably damaging	Het
Cabp5	T	A	7: 13,398,342	L12*	probably null	Het
Cachd1	T	C	4: 100,988,598	V993A	possibly damaging	Het
Cd44	G	A	2: 102,831,383	T306I	probably damaging	Het
Cdc20	A	T	4: 118,437,056	N22K	probably benign	Het
Cdc6	T	A	11: 98,916,981	D433E	possibly damaging	Het
Clhc1	A	G	11: 29,553,725	D47G	probably damaging	Het
Csf2	T	C	11: 54,248,563	K65E	probably benign	Het
Cul9	T	C	17: 46,508,547	E2005G	probably damaging	Het
Dclk3	G	T	9: 111,467,820	R144L	possibly damaging	Het
Dcpp2	C	T	17: 23,900,542	T110I	probably damaging	Het
Disp1	A	T	1: 183,086,474	F1461I	possibly damaging	Het
Dnah1	C	T	14: 31,294,874	G1562D	probably damaging	Het
Exoc3l2	C	A	7: 19,495,359	P234Q	probably damaging	Het
F2rl2	T	C	13: 95,701,539	V364A	probably benign	Het
Fam151a	T	C	4: 106,745,679	L265P	probably damaging	Het
Fam151b	T	A	13: 92,450,166	Q253L	probably benign	Het
Fat1	G	A	8: 44,953,244	V1011M	probably benign	Het
Fbxo6	G	A	4: 148,145,984	R274*	probably null	Het
Fgd4	G	T	16: 16,484,473	Q73K	probably benign	Het
Fth1	A	G	19: 9,984,853	T154A	probably benign	Het
Hgs	C	A	11: 120,480,040	H572Q	probably benign	Het
Kcnk10	G	A	12: 98,489,948	T208I	probably damaging	Het
Kdm5b	G	A	1: 134,624,897	V1204M	probably damaging	Het
Keg1	A	C	19: 12,718,821	H166P	probably damaging	Het
Llcfc1	A	T	6: 41,685,284	D74V	probably damaging	Het
Lman2	A	G	13: 55,351,405	V219A	possibly damaging	Het
Mettl25	A	G	10: 105,826,590	I173T	possibly damaging	Het
Mov10	G	T	3: 104,804,546	P170Q	probably damaging	Het
Mtif2	G	T	11: 29,536,847	A286S	probably damaging	Het
Mtmr10	A	G	7: 64,314,249	Y244C	probably damaging	Het
Nbea	A	T	3: 56,079,993	C359S	probably damaging	Het
Nbr1	C	T	11: 101,572,841	T633I	probably benign	Het
Nepn	A	T	10: 52,400,416	T22S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Oacyl	T	A	18: 65,737,972	L342M	probably damaging	Het
Olfr691	T	A	7: 105,337,256	R153S	probably damaging	Het
Olfr699	A	G	7: 106,790,333	F223L	probably benign	Het
Olfr775	T	A	10: 129,251,143	I203N	possibly damaging	Het
Olfr872	G	A	9: 20,260,724	V295I	possibly damaging	Het
Oxnad1	T	C	14: 32,099,633		probably null	Het
Pard3b	A	T	1: 62,166,367	D440V	probably damaging	Het
Pou3f2	T	G	4: 22,486,960	D391A	possibly damaging	Het
Ptprk	T	C	10: 28,263,516	V79A	probably benign	Het
Rwdd2a	A	G	9: 86,574,278	D169G	probably damaging	Het
Scn3b	A	C	9: 40,279,496	D74A	probably damaging	Het
Setbp1	C	T	18: 79,086,835	D61N	probably damaging	Het
Setx	T	A	2: 29,162,992	D2089E	probably damaging	Het
Vmn2r69	C	G	7: 85,406,874	W685C	probably damaging	Het
Vps8	A	G	16: 21,581,598	Q1272R	probably benign	Het
Wnk4	T	C	11: 101,269,636	F699L	probably damaging	Het
Zfp616	T	A	11: 74,083,977	N448K	possibly damaging	Het
Zfp618	C	A	4: 63,115,448	D307E	possibly damaging	Het
Zfp687	A	G	3: 95,007,533	F1219S	probably damaging	Het
Zfpm2	T	A	15: 41,099,291	D248E	probably damaging	Het

Other mutations in Kifap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00737:Kifap3	APN	1	163797270	missense	probably damaging	1.00
IGL01655:Kifap3	APN	1	163796049	splice site	probably benign
IGL02385:Kifap3	APN	1	163865444	nonsense	probably null
IGL02517:Kifap3	APN	1	163825871	splice site	probably benign
IGL02756:Kifap3	APN	1	163862028	missense	probably damaging	0.98
IGL03034:Kifap3	APN	1	163888277	missense	probably benign	0.05
IGL03230:Kifap3	APN	1	163825724	missense	probably benign	0.02
IGL03270:Kifap3	APN	1	163848733	missense	probably benign	0.18
IGL03340:Kifap3	APN	1	163829149	missense	possibly damaging	0.94
R0207:Kifap3	UTSW	1	163883386	missense	probably benign	0.00
R0333:Kifap3	UTSW	1	163797264	missense	probably damaging	1.00
R0426:Kifap3	UTSW	1	163865552	splice site	probably benign
R1467:Kifap3	UTSW	1	163829120	splice site	probably benign
R1547:Kifap3	UTSW	1	163794086	missense	probably benign	0.01
R1704:Kifap3	UTSW	1	163829196	missense	possibly damaging	0.50
R1724:Kifap3	UTSW	1	163783097	nonsense	probably null
R1982:Kifap3	UTSW	1	163862022	nonsense	probably null
R2233:Kifap3	UTSW	1	163856065	missense	probably benign
R2273:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R2274:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R2275:Kifap3	UTSW	1	163868758	missense	possibly damaging	0.94
R3420:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R3421:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R3422:Kifap3	UTSW	1	163794026	missense	probably damaging	1.00
R4194:Kifap3	UTSW	1	163915825	missense	probably benign	0.10
R4260:Kifap3	UTSW	1	163862028	missense	probably damaging	0.98
R4464:Kifap3	UTSW	1	163817895	missense	probably benign	0.00
R4635:Kifap3	UTSW	1	163814435	missense	probably damaging	1.00
R5090:Kifap3	UTSW	1	163856076	missense	possibly damaging	0.89
R5426:Kifap3	UTSW	1	163779871	start codon destroyed	probably null	0.30
R5868:Kifap3	UTSW	1	163865472	missense	probably damaging	1.00
R6107:Kifap3	UTSW	1	163868769	missense	possibly damaging	0.50
R6437:Kifap3	UTSW	1	163857526	missense	probably damaging	0.99
R6744:Kifap3	UTSW	1	163848670	missense	probably benign	0.00
R7051:Kifap3	UTSW	1	163794080	missense	probably damaging	1.00
R7143:Kifap3	UTSW	1	163825859	missense	possibly damaging	0.91
R7143:Kifap3	UTSW	1	163856040	missense	possibly damaging	0.66
R7216:Kifap3	UTSW	1	163795989	missense	probably damaging	0.98
R7467:Kifap3	UTSW	1	163815833	missense	probably benign
R7564:Kifap3	UTSW	1	163915768	missense	probably damaging	1.00
R7939:Kifap3	UTSW	1	163815858	nonsense	probably null
R8108:Kifap3	UTSW	1	163797362	missense	probably damaging	0.99
R8496:Kifap3	UTSW	1	163829297	critical splice donor site	probably null
R9009:Kifap3	UTSW	1	163868722	missense	probably damaging	0.97
R9212:Kifap3	UTSW	1	163783031	missense	probably damaging	1.00
R9228:Kifap3	UTSW	1	163862097	missense	probably benign	0.11
R9350:Kifap3	UTSW	1	163783061	missense	probably benign	0.02
U24488:Kifap3	UTSW	1	163783035	missense	possibly damaging	0.64
Z1177:Kifap3	UTSW	1	163862062	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTTTGAATCTTGCGGAGGACACAC -3'
(R):5'- GCTCTGACTTCTCACAAAACTGAGCAC -3'

Sequencing Primer
(F):5'- CACACGTACAGAACTGAAGATG -3'
(R):5'- CACTTCTTATAACTCTGGGTGAGTAG -3'

Posted On

2014-03-28