Mutagenetix > Incidental Mutations

Incidental Mutation 'R1482:Disp1'

164420

Institutional Source

Beutler Lab

Gene Symbol

Disp1

Ensembl Gene

ENSMUSG00000030768

Gene Name

dispatched RND transporter family member 1

Synonyms

1190008H24Rik, DispA

MMRRC Submission

039535-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.857) question?

Stock #

R1482 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

183086266-183221522 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 183086474 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 1461 (F1461I)

Ref Sequence

ENSEMBL: ENSMUSP00000141747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000003035
AA Change: F1461I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: F1461I

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	279	765	6.8e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	518	670	1.7e-15	PFAM
Pfam:Patched	916	1130	8e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000171366
AA Change: F1461I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: F1461I

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000195372
AA Change: F1461I

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: F1461I

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 83.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	G	A	19: 3,717,192	D260N	probably benign	Het
AI314180	T	C	4: 58,820,163	K1217E	possibly damaging	Het
Ankef1	A	T	2: 136,550,158	K422N	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Aqp6	A	T	15: 99,604,307	*294C	probably null	Het
Baz2a	T	A	10: 128,109,008	M38K	possibly damaging	Het
Bcl2l14	A	G	6: 134,427,302	D151G	probably damaging	Het
Cabp5	T	A	7: 13,398,342	L12*	probably null	Het
Cachd1	T	C	4: 100,988,598	V993A	possibly damaging	Het
Cd44	G	A	2: 102,831,383	T306I	probably damaging	Het
Cdc20	A	T	4: 118,437,056	N22K	probably benign	Het
Cdc6	T	A	11: 98,916,981	D433E	possibly damaging	Het
Clhc1	A	G	11: 29,553,725	D47G	probably damaging	Het
Csf2	T	C	11: 54,248,563	K65E	probably benign	Het
Cul9	T	C	17: 46,508,547	E2005G	probably damaging	Het
Dclk3	G	T	9: 111,467,820	R144L	possibly damaging	Het
Dcpp2	C	T	17: 23,900,542	T110I	probably damaging	Het
Dnah1	C	T	14: 31,294,874	G1562D	probably damaging	Het
Exoc3l2	C	A	7: 19,495,359	P234Q	probably damaging	Het
F2rl2	T	C	13: 95,701,539	V364A	probably benign	Het
Fam151a	T	C	4: 106,745,679	L265P	probably damaging	Het
Fam151b	T	A	13: 92,450,166	Q253L	probably benign	Het
Fat1	G	A	8: 44,953,244	V1011M	probably benign	Het
Fbxo6	G	A	4: 148,145,984	R274*	probably null	Het
Fgd4	G	T	16: 16,484,473	Q73K	probably benign	Het
Fth1	A	G	19: 9,984,853	T154A	probably benign	Het
Hgs	C	A	11: 120,480,040	H572Q	probably benign	Het
Kcnk10	G	A	12: 98,489,948	T208I	probably damaging	Het
Kdm5b	G	A	1: 134,624,897	V1204M	probably damaging	Het
Keg1	A	C	19: 12,718,821	H166P	probably damaging	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Llcfc1	A	T	6: 41,685,284	D74V	probably damaging	Het
Lman2	A	G	13: 55,351,405	V219A	possibly damaging	Het
Mettl25	A	G	10: 105,826,590	I173T	possibly damaging	Het
Mov10	G	T	3: 104,804,546	P170Q	probably damaging	Het
Mtif2	G	T	11: 29,536,847	A286S	probably damaging	Het
Mtmr10	A	G	7: 64,314,249	Y244C	probably damaging	Het
Nbea	A	T	3: 56,079,993	C359S	probably damaging	Het
Nbr1	C	T	11: 101,572,841	T633I	probably benign	Het
Nepn	A	T	10: 52,400,416	T22S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Oacyl	T	A	18: 65,737,972	L342M	probably damaging	Het
Olfr691	T	A	7: 105,337,256	R153S	probably damaging	Het
Olfr699	A	G	7: 106,790,333	F223L	probably benign	Het
Olfr775	T	A	10: 129,251,143	I203N	possibly damaging	Het
Olfr872	G	A	9: 20,260,724	V295I	possibly damaging	Het
Oxnad1	T	C	14: 32,099,633		probably null	Het
Pard3b	A	T	1: 62,166,367	D440V	probably damaging	Het
Pou3f2	T	G	4: 22,486,960	D391A	possibly damaging	Het
Ptprk	T	C	10: 28,263,516	V79A	probably benign	Het
Rwdd2a	A	G	9: 86,574,278	D169G	probably damaging	Het
Scn3b	A	C	9: 40,279,496	D74A	probably damaging	Het
Setbp1	C	T	18: 79,086,835	D61N	probably damaging	Het
Setx	T	A	2: 29,162,992	D2089E	probably damaging	Het
Vmn2r69	C	G	7: 85,406,874	W685C	probably damaging	Het
Vps8	A	G	16: 21,581,598	Q1272R	probably benign	Het
Wnk4	T	C	11: 101,269,636	F699L	probably damaging	Het
Zfp616	T	A	11: 74,083,977	N448K	possibly damaging	Het
Zfp618	C	A	4: 63,115,448	D307E	possibly damaging	Het
Zfp687	A	G	3: 95,007,533	F1219S	probably damaging	Het
Zfpm2	T	A	15: 41,099,291	D248E	probably damaging	Het

Other mutations in Disp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R1120:Disp1	UTSW	1	183098575	missense	probably benign	0.24
R1655:Disp1	UTSW	1	183087004	missense	probably benign	0.01
R1660:Disp1	UTSW	1	183087742	missense	probably damaging	1.00
R1816:Disp1	UTSW	1	183098575	missense	probably damaging	0.99
R1835:Disp1	UTSW	1	183089000	missense	probably damaging	1.00
R1954:Disp1	UTSW	1	183088543	missense	probably damaging	0.99
R2025:Disp1	UTSW	1	183088203	missense	probably damaging	1.00
R2136:Disp1	UTSW	1	183088378	missense	probably damaging	1.00
R2150:Disp1	UTSW	1	183088372	missense	probably damaging	1.00
R2207:Disp1	UTSW	1	183088342	missense	possibly damaging	0.94
R2392:Disp1	UTSW	1	183087167	missense	probably benign
R2831:Disp1	UTSW	1	183089319	small deletion	probably benign
R3111:Disp1	UTSW	1	183087523	missense	probably damaging	1.00
R3116:Disp1	UTSW	1	183088922	missense	probably benign	0.01
R3160:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3161:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3162:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3162:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3716:Disp1	UTSW	1	183087751	missense	probably damaging	1.00
R3914:Disp1	UTSW	1	183089102	missense	probably benign	0.05
R4061:Disp1	UTSW	1	183087700	missense	probably damaging	0.96
R4191:Disp1	UTSW	1	183089173	missense	probably damaging	1.00
R4261:Disp1	UTSW	1	183089386	missense	probably damaging	1.00
R4272:Disp1	UTSW	1	183087644	missense	possibly damaging	0.95
R4273:Disp1	UTSW	1	183087644	missense	possibly damaging	0.95
R4351:Disp1	UTSW	1	183099978	missense	probably benign	0.01
R4672:Disp1	UTSW	1	183098651	critical splice acceptor site	probably null
R4764:Disp1	UTSW	1	183088096	missense	probably damaging	1.00
R4910:Disp1	UTSW	1	183135463	missense	probably damaging	1.00
R5150:Disp1	UTSW	1	183089499	missense	probably damaging	0.98
R5502:Disp1	UTSW	1	183087886	missense	probably damaging	1.00
R5616:Disp1	UTSW	1	183088349	missense	probably benign	0.30
R5699:Disp1	UTSW	1	183088555	nonsense	probably null
R5813:Disp1	UTSW	1	183088410	missense	probably damaging	1.00
R5820:Disp1	UTSW	1	183135587	missense	probably benign	0.00
R6184:Disp1	UTSW	1	183086332	missense	probably benign	0.00
R6228:Disp1	UTSW	1	183099025	missense	possibly damaging	0.59
R6306:Disp1	UTSW	1	183087148	missense	possibly damaging	0.93
R6505:Disp1	UTSW	1	183086512	missense	probably benign	0.02
R6925:Disp1	UTSW	1	183086478	missense	probably benign
R7016:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7045:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7046:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7047:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7114:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7123:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7124:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7125:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7161:Disp1	UTSW	1	183087625	missense	possibly damaging	0.84
R7510:Disp1	UTSW	1	183088411	missense	probably damaging	1.00
R7756:Disp1	UTSW	1	183089734	missense	probably damaging	1.00
R7800:Disp1	UTSW	1	183098986	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTAAGCACGGTGACACATGGG -3'
(R):5'- GACAGCAGGAGCACTGAGTCTTTC -3'

Sequencing Primer
(F):5'- TGACACATGGGACATGCCTG -3'
(R):5'- AAAGAGCTTGTTGCCATCCTG -3'

Posted On

2014-03-28