Incidental Mutation 'R1482:Nbea'
ID 164428
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission 039535-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1482 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 55532616-56091122 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 55987414 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 359 (C359S)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029374
AA Change: C359S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: C359S

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,767,192 (GRCm39) D260N probably benign Het
Ankef1 A T 2: 136,392,078 (GRCm39) K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Aqp6 A T 15: 99,502,188 (GRCm39) *294C probably null Het
Baz2a T A 10: 127,944,877 (GRCm39) M38K possibly damaging Het
Bcl2l14 A G 6: 134,404,265 (GRCm39) D151G probably damaging Het
Cabp5 T A 7: 13,132,267 (GRCm39) L12* probably null Het
Cachd1 T C 4: 100,845,795 (GRCm39) V993A possibly damaging Het
Cd44 G A 2: 102,661,728 (GRCm39) T306I probably damaging Het
Cdc20 A T 4: 118,294,253 (GRCm39) N22K probably benign Het
Cdc6 T A 11: 98,807,807 (GRCm39) D433E possibly damaging Het
Clhc1 A G 11: 29,503,725 (GRCm39) D47G probably damaging Het
Csf2 T C 11: 54,139,389 (GRCm39) K65E probably benign Het
Cul9 T C 17: 46,819,473 (GRCm39) E2005G probably damaging Het
Dclk3 G T 9: 111,296,888 (GRCm39) R144L possibly damaging Het
Dcpp2 C T 17: 24,119,516 (GRCm39) T110I probably damaging Het
Disp1 A T 1: 182,868,038 (GRCm39) F1461I possibly damaging Het
Dnah1 C T 14: 31,016,831 (GRCm39) G1562D probably damaging Het
Ecpas T C 4: 58,820,163 (GRCm39) K1217E possibly damaging Het
Exoc3l2 C A 7: 19,229,284 (GRCm39) P234Q probably damaging Het
F2rl2 T C 13: 95,838,047 (GRCm39) V364A probably benign Het
Fam151a T C 4: 106,602,876 (GRCm39) L265P probably damaging Het
Fam151b T A 13: 92,586,674 (GRCm39) Q253L probably benign Het
Fat1 G A 8: 45,406,281 (GRCm39) V1011M probably benign Het
Fbxo6 G A 4: 148,230,441 (GRCm39) R274* probably null Het
Fgd4 G T 16: 16,302,337 (GRCm39) Q73K probably benign Het
Fth1 A G 19: 9,962,217 (GRCm39) T154A probably benign Het
Hgs C A 11: 120,370,866 (GRCm39) H572Q probably benign Het
Kcnk10 G A 12: 98,456,207 (GRCm39) T208I probably damaging Het
Kdm5b G A 1: 134,552,635 (GRCm39) V1204M probably damaging Het
Keg1 A C 19: 12,696,185 (GRCm39) H166P probably damaging Het
Kifap3 A T 1: 163,653,428 (GRCm39) N338I possibly damaging Het
Llcfc1 A T 6: 41,662,218 (GRCm39) D74V probably damaging Het
Lman2 A G 13: 55,499,218 (GRCm39) V219A possibly damaging Het
Mettl25 A G 10: 105,662,451 (GRCm39) I173T possibly damaging Het
Mov10 G T 3: 104,711,862 (GRCm39) P170Q probably damaging Het
Mtif2 G T 11: 29,486,847 (GRCm39) A286S probably damaging Het
Mtmr10 A G 7: 63,963,997 (GRCm39) Y244C probably damaging Het
Nbr1 C T 11: 101,463,667 (GRCm39) T633I probably benign Het
Nepn A T 10: 52,276,512 (GRCm39) T22S probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Oacyl T A 18: 65,871,043 (GRCm39) L342M probably damaging Het
Or2ag17 A G 7: 106,389,540 (GRCm39) F223L probably benign Het
Or52b2 T A 7: 104,986,463 (GRCm39) R153S probably damaging Het
Or6c205 T A 10: 129,087,012 (GRCm39) I203N possibly damaging Het
Or7e176 G A 9: 20,172,020 (GRCm39) V295I possibly damaging Het
Oxnad1 T C 14: 31,821,590 (GRCm39) probably null Het
Pard3b A T 1: 62,205,526 (GRCm39) D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 (GRCm39) D391A possibly damaging Het
Ptprk T C 10: 28,139,512 (GRCm39) V79A probably benign Het
Rwdd2a A G 9: 86,456,331 (GRCm39) D169G probably damaging Het
Scn3b A C 9: 40,190,792 (GRCm39) D74A probably damaging Het
Setbp1 C T 18: 79,130,050 (GRCm39) D61N probably damaging Het
Setx T A 2: 29,053,004 (GRCm39) D2089E probably damaging Het
Vmn2r69 C G 7: 85,056,082 (GRCm39) W685C probably damaging Het
Vps8 A G 16: 21,400,348 (GRCm39) Q1272R probably benign Het
Wnk4 T C 11: 101,160,462 (GRCm39) F699L probably damaging Het
Zfp616 T A 11: 73,974,803 (GRCm39) N448K possibly damaging Het
Zfp618 C A 4: 63,033,685 (GRCm39) D307E possibly damaging Het
Zfp687 A G 3: 94,914,844 (GRCm39) F1219S probably damaging Het
Zfpm2 T A 15: 40,962,687 (GRCm39) D248E probably damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55,535,914 (GRCm39) missense probably damaging 1.00
IGL00541:Nbea APN 3 55,875,510 (GRCm39) missense probably benign 0.02
IGL00584:Nbea APN 3 55,989,869 (GRCm39) missense probably damaging 0.98
IGL00648:Nbea APN 3 55,916,681 (GRCm39) missense probably damaging 0.98
IGL00785:Nbea APN 3 55,862,814 (GRCm39) missense probably benign
IGL00899:Nbea APN 3 55,550,266 (GRCm39) missense probably benign 0.32
IGL00955:Nbea APN 3 55,912,893 (GRCm39) missense possibly damaging 0.45
IGL01296:Nbea APN 3 55,938,957 (GRCm39) missense probably benign 0.04
IGL01299:Nbea APN 3 55,598,315 (GRCm39) missense probably damaging 1.00
IGL01393:Nbea APN 3 55,912,729 (GRCm39) missense probably benign 0.02
IGL01550:Nbea APN 3 55,712,669 (GRCm39) missense possibly damaging 0.93
IGL02023:Nbea APN 3 55,588,437 (GRCm39) missense probably damaging 1.00
IGL02034:Nbea APN 3 55,875,577 (GRCm39) missense probably damaging 1.00
IGL02061:Nbea APN 3 55,625,308 (GRCm39) missense possibly damaging 0.54
IGL02082:Nbea APN 3 55,875,588 (GRCm39) missense possibly damaging 0.88
IGL02113:Nbea APN 3 55,899,913 (GRCm39) missense probably benign
IGL02188:Nbea APN 3 55,891,258 (GRCm39) missense probably benign 0.00
IGL02319:Nbea APN 3 55,893,159 (GRCm39) missense probably damaging 1.00
IGL02406:Nbea APN 3 55,993,687 (GRCm39) missense probably benign 0.02
IGL02494:Nbea APN 3 55,712,772 (GRCm39) missense probably benign 0.02
IGL02550:Nbea APN 3 55,926,835 (GRCm39) missense probably damaging 0.98
IGL02706:Nbea APN 3 55,944,699 (GRCm39) missense probably damaging 1.00
IGL02718:Nbea APN 3 55,539,483 (GRCm39) nonsense probably null
IGL02822:Nbea APN 3 55,926,868 (GRCm39) missense possibly damaging 0.93
IGL02885:Nbea APN 3 55,539,407 (GRCm39) missense probably benign 0.01
IGL03000:Nbea APN 3 55,912,048 (GRCm39) missense possibly damaging 0.94
IGL03081:Nbea APN 3 55,987,339 (GRCm39) missense probably damaging 1.00
IGL03091:Nbea APN 3 55,992,725 (GRCm39) missense probably damaging 1.00
IGL03368:Nbea APN 3 55,987,351 (GRCm39) missense probably damaging 0.98
Neches UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
scotland UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
Wales UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
FR4340:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
G4846:Nbea UTSW 3 55,994,918 (GRCm39) missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55,625,290 (GRCm39) missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55,608,948 (GRCm39) intron probably benign
R0087:Nbea UTSW 3 55,998,444 (GRCm39) missense possibly damaging 0.92
R0220:Nbea UTSW 3 55,912,724 (GRCm39) missense probably benign 0.30
R0324:Nbea UTSW 3 55,965,369 (GRCm39) critical splice donor site probably null
R0330:Nbea UTSW 3 55,550,238 (GRCm39) missense probably benign 0.27
R0391:Nbea UTSW 3 55,944,698 (GRCm39) missense probably damaging 1.00
R0394:Nbea UTSW 3 55,937,328 (GRCm39) missense probably damaging 1.00
R0419:Nbea UTSW 3 55,726,715 (GRCm39) missense probably benign 0.05
R0503:Nbea UTSW 3 55,550,257 (GRCm39) missense possibly damaging 0.79
R0521:Nbea UTSW 3 55,915,689 (GRCm39) missense probably damaging 1.00
R0595:Nbea UTSW 3 55,535,917 (GRCm39) missense probably benign 0.18
R0894:Nbea UTSW 3 55,916,761 (GRCm39) missense possibly damaging 0.89
R1072:Nbea UTSW 3 55,993,617 (GRCm39) missense possibly damaging 0.94
R1125:Nbea UTSW 3 55,764,427 (GRCm39) nonsense probably null
R1169:Nbea UTSW 3 55,875,744 (GRCm39) missense probably benign 0.00
R1241:Nbea UTSW 3 55,965,461 (GRCm39) missense probably damaging 1.00
R1269:Nbea UTSW 3 55,912,202 (GRCm39) missense probably benign 0.05
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1406:Nbea UTSW 3 55,944,702 (GRCm39) missense probably benign 0.00
R1457:Nbea UTSW 3 55,992,748 (GRCm39) missense probably damaging 1.00
R1483:Nbea UTSW 3 55,910,211 (GRCm39) missense probably benign 0.25
R1502:Nbea UTSW 3 55,912,310 (GRCm39) missense probably benign 0.03
R1544:Nbea UTSW 3 55,966,248 (GRCm39) missense probably damaging 0.99
R1629:Nbea UTSW 3 55,910,312 (GRCm39) missense possibly damaging 0.52
R1647:Nbea UTSW 3 55,537,650 (GRCm39) missense probably damaging 0.97
R1663:Nbea UTSW 3 55,553,407 (GRCm39) missense possibly damaging 0.95
R1722:Nbea UTSW 3 55,573,116 (GRCm39) missense probably damaging 1.00
R1757:Nbea UTSW 3 55,537,610 (GRCm39) missense possibly damaging 0.83
R1771:Nbea UTSW 3 55,841,940 (GRCm39) missense probably benign 0.00
R1796:Nbea UTSW 3 55,551,129 (GRCm39) missense possibly damaging 0.48
R1844:Nbea UTSW 3 55,989,857 (GRCm39) missense probably damaging 0.97
R1872:Nbea UTSW 3 55,550,310 (GRCm39) missense probably benign 0.12
R1938:Nbea UTSW 3 55,992,743 (GRCm39) missense probably damaging 1.00
R1940:Nbea UTSW 3 55,860,521 (GRCm39) missense possibly damaging 0.78
R2062:Nbea UTSW 3 55,993,578 (GRCm39) splice site probably benign
R2066:Nbea UTSW 3 55,875,567 (GRCm39) missense probably damaging 1.00
R2097:Nbea UTSW 3 55,630,638 (GRCm39) missense probably damaging 0.96
R2181:Nbea UTSW 3 55,937,360 (GRCm39) missense possibly damaging 0.92
R2274:Nbea UTSW 3 55,895,506 (GRCm39) splice site probably null
R2345:Nbea UTSW 3 55,992,700 (GRCm39) missense probably damaging 1.00
R2423:Nbea UTSW 3 55,992,727 (GRCm39) missense probably damaging 1.00
R2434:Nbea UTSW 3 55,554,881 (GRCm39) missense possibly damaging 0.91
R2880:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2881:Nbea UTSW 3 55,554,779 (GRCm39) missense probably benign 0.04
R2940:Nbea UTSW 3 55,842,045 (GRCm39) missense probably benign 0.24
R3500:Nbea UTSW 3 55,588,431 (GRCm39) missense possibly damaging 0.88
R3765:Nbea UTSW 3 55,912,970 (GRCm39) missense probably damaging 1.00
R3790:Nbea UTSW 3 55,912,450 (GRCm39) missense probably benign
R3808:Nbea UTSW 3 55,625,269 (GRCm39) missense probably benign 0.02
R3845:Nbea UTSW 3 55,993,713 (GRCm39) splice site probably benign
R4182:Nbea UTSW 3 55,915,848 (GRCm39) missense probably damaging 0.99
R4385:Nbea UTSW 3 55,908,059 (GRCm39) missense possibly damaging 0.77
R4419:Nbea UTSW 3 55,917,021 (GRCm39) missense probably damaging 1.00
R4426:Nbea UTSW 3 55,989,800 (GRCm39) missense probably damaging 0.98
R4451:Nbea UTSW 3 55,899,753 (GRCm39) critical splice donor site probably null
R4456:Nbea UTSW 3 55,551,205 (GRCm39) missense probably benign 0.00
R4604:Nbea UTSW 3 55,631,069 (GRCm39) missense probably benign 0.18
R4687:Nbea UTSW 3 55,965,486 (GRCm39) missense probably damaging 1.00
R4758:Nbea UTSW 3 55,912,824 (GRCm39) missense probably benign
R4840:Nbea UTSW 3 55,618,091 (GRCm39) missense probably benign 0.37
R4888:Nbea UTSW 3 55,912,776 (GRCm39) missense possibly damaging 0.61
R4954:Nbea UTSW 3 55,943,379 (GRCm39) missense probably damaging 1.00
R4972:Nbea UTSW 3 55,992,667 (GRCm39) missense probably damaging 0.99
R4980:Nbea UTSW 3 55,860,466 (GRCm39) missense probably benign 0.00
R4980:Nbea UTSW 3 55,554,772 (GRCm39) splice site probably null
R5104:Nbea UTSW 3 55,987,348 (GRCm39) missense probably damaging 1.00
R5139:Nbea UTSW 3 55,534,384 (GRCm39) missense possibly damaging 0.90
R5166:Nbea UTSW 3 55,926,874 (GRCm39) missense probably damaging 1.00
R5347:Nbea UTSW 3 55,948,297 (GRCm39) missense probably damaging 1.00
R5350:Nbea UTSW 3 55,926,845 (GRCm39) missense probably damaging 1.00
R5418:Nbea UTSW 3 55,553,410 (GRCm39) missense possibly damaging 0.86
R5586:Nbea UTSW 3 55,539,392 (GRCm39) missense probably benign 0.08
R5627:Nbea UTSW 3 55,899,766 (GRCm39) missense probably damaging 1.00
R5683:Nbea UTSW 3 55,536,007 (GRCm39) missense possibly damaging 0.53
R5765:Nbea UTSW 3 55,912,719 (GRCm39) missense probably benign 0.15
R5853:Nbea UTSW 3 55,899,822 (GRCm39) missense probably damaging 1.00
R5858:Nbea UTSW 3 55,860,455 (GRCm39) critical splice donor site probably null
R5955:Nbea UTSW 3 55,588,404 (GRCm39) missense probably benign 0.00
R5976:Nbea UTSW 3 55,761,268 (GRCm39) missense probably benign 0.30
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6039:Nbea UTSW 3 55,912,538 (GRCm39) missense probably benign 0.00
R6043:Nbea UTSW 3 55,693,896 (GRCm39) missense probably benign 0.32
R6122:Nbea UTSW 3 55,937,317 (GRCm39) missense probably damaging 1.00
R6218:Nbea UTSW 3 55,535,905 (GRCm39) missense probably damaging 0.97
R6331:Nbea UTSW 3 55,908,037 (GRCm39) missense possibly damaging 0.94
R6334:Nbea UTSW 3 55,944,570 (GRCm39) missense probably damaging 1.00
R6393:Nbea UTSW 3 55,998,540 (GRCm39) missense probably damaging 1.00
R6411:Nbea UTSW 3 55,712,778 (GRCm39) missense probably benign 0.01
R6457:Nbea UTSW 3 55,907,990 (GRCm39) missense probably damaging 1.00
R6476:Nbea UTSW 3 55,912,227 (GRCm39) missense probably benign 0.00
R6488:Nbea UTSW 3 55,625,264 (GRCm39) missense probably damaging 0.99
R6700:Nbea UTSW 3 55,989,869 (GRCm39) missense possibly damaging 0.89
R6702:Nbea UTSW 3 55,912,923 (GRCm39) missense probably benign 0.06
R6752:Nbea UTSW 3 55,944,640 (GRCm39) missense probably benign
R6752:Nbea UTSW 3 55,875,730 (GRCm39) missense probably benign 0.02
R6804:Nbea UTSW 3 55,994,874 (GRCm39) missense probably benign 0.37
R6901:Nbea UTSW 3 55,926,836 (GRCm39) missense probably damaging 1.00
R6933:Nbea UTSW 3 55,631,031 (GRCm39) missense possibly damaging 0.63
R7124:Nbea UTSW 3 55,899,865 (GRCm39) missense probably damaging 1.00
R7211:Nbea UTSW 3 55,912,322 (GRCm39) missense probably benign 0.05
R7308:Nbea UTSW 3 55,998,452 (GRCm39) missense probably damaging 1.00
R7405:Nbea UTSW 3 55,712,687 (GRCm39) missense possibly damaging 0.94
R7669:Nbea UTSW 3 55,625,200 (GRCm39) missense probably damaging 1.00
R7762:Nbea UTSW 3 55,557,126 (GRCm39) missense probably damaging 1.00
R7833:Nbea UTSW 3 55,910,218 (GRCm39) missense probably damaging 1.00
R7885:Nbea UTSW 3 55,573,110 (GRCm39) missense probably damaging 0.97
R7935:Nbea UTSW 3 55,966,086 (GRCm39) missense probably damaging 1.00
R8050:Nbea UTSW 3 55,895,402 (GRCm39) missense probably damaging 0.99
R8108:Nbea UTSW 3 55,726,736 (GRCm39) missense probably benign 0.11
R8290:Nbea UTSW 3 55,966,056 (GRCm39) nonsense probably null
R8314:Nbea UTSW 3 55,916,672 (GRCm39) missense probably damaging 0.99
R8321:Nbea UTSW 3 56,090,518 (GRCm39) missense possibly damaging 0.86
R8376:Nbea UTSW 3 55,551,076 (GRCm39) missense possibly damaging 0.79
R8410:Nbea UTSW 3 55,944,684 (GRCm39) missense probably damaging 1.00
R8556:Nbea UTSW 3 55,554,807 (GRCm39) missense probably benign 0.25
R8753:Nbea UTSW 3 55,534,329 (GRCm39) missense probably damaging 1.00
R8844:Nbea UTSW 3 55,998,415 (GRCm39) missense probably damaging 0.97
R8884:Nbea UTSW 3 55,712,720 (GRCm39) missense probably benign 0.00
R8886:Nbea UTSW 3 55,966,148 (GRCm39) missense probably damaging 1.00
R8890:Nbea UTSW 3 55,926,784 (GRCm39) splice site probably benign
R9004:Nbea UTSW 3 55,910,359 (GRCm39) missense probably benign 0.01
R9022:Nbea UTSW 3 55,551,110 (GRCm39) missense possibly damaging 0.79
R9080:Nbea UTSW 3 55,912,516 (GRCm39) nonsense probably null
R9087:Nbea UTSW 3 55,550,157 (GRCm39) critical splice donor site probably null
R9104:Nbea UTSW 3 55,862,809 (GRCm39) missense probably benign
R9165:Nbea UTSW 3 55,912,289 (GRCm39) missense probably benign 0.15
R9219:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9221:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9222:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9260:Nbea UTSW 3 55,891,233 (GRCm39) missense possibly damaging 0.50
R9263:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9265:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9294:Nbea UTSW 3 55,998,513 (GRCm39) missense probably benign 0.00
R9360:Nbea UTSW 3 55,943,319 (GRCm39) missense possibly damaging 0.96
R9387:Nbea UTSW 3 55,898,460 (GRCm39) missense probably benign 0.12
R9428:Nbea UTSW 3 55,998,393 (GRCm39) frame shift probably null
R9435:Nbea UTSW 3 55,943,309 (GRCm39) missense possibly damaging 0.63
R9507:Nbea UTSW 3 55,573,011 (GRCm39) missense probably damaging 1.00
R9514:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9516:Nbea UTSW 3 55,937,366 (GRCm39) missense probably damaging 1.00
R9674:Nbea UTSW 3 55,966,183 (GRCm39) missense probably damaging 1.00
R9688:Nbea UTSW 3 55,557,165 (GRCm39) missense probably benign 0.42
R9709:Nbea UTSW 3 55,693,879 (GRCm39) nonsense probably null
RF051:Nbea UTSW 3 55,916,633 (GRCm39) critical splice donor site probably benign
X0018:Nbea UTSW 3 55,943,469 (GRCm39) missense probably benign 0.39
Z1088:Nbea UTSW 3 55,630,584 (GRCm39) missense probably benign 0.34
Z1177:Nbea UTSW 3 55,938,971 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGGTTATACAACAAGACCTTTGCTGA -3'
(R):5'- GTGTGCCAGGCTTTCTAGATGAAAGAT -3'

Sequencing Primer
(F):5'- GCTGAGAACTTATATCAATGCAGTC -3'
(R):5'- AAAATGGGGGTTGCCTATTCATC -3'
Posted On 2014-03-28