Incidental Mutation 'R1482:Pou3f2'
ID 164431
Institutional Source Beutler Lab
Gene Symbol Pou3f2
Ensembl Gene ENSMUSG00000095139
Gene Name POU domain, class 3, transcription factor 2
Synonyms Otf7, Brn-2, Brn2, A230098E07Rik, 9430075J19Rik
MMRRC Submission 039535-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R1482 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 22482780-22488366 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 22486960 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 391 (D391A)
Ref Sequence ENSEMBL: ENSMUSP00000136147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000178174]
AlphaFold P31360
Predicted Effect possibly damaging
Transcript: ENSMUST00000178174
AA Change: D391A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000136147
Gene: ENSMUSG00000095139
AA Change: D391A

DomainStartEndE-ValueType
coiled coil region 122 152 N/A INTRINSIC
low complexity region 158 169 N/A INTRINSIC
low complexity region 220 261 N/A INTRINSIC
POU 264 338 9.06e-54 SMART
HOX 356 418 4.2e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203909
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU-III class of neural transcription factors. The encoded protein is involved in neuronal differentiation and enhances the activation of corticotropin-releasing hormone regulated genes. Overexpression of this protein is associated with an increase in the proliferation of melanoma cells. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous mutation of this gene results in lethality by 10 days of age. Mutant animals are growth retarded, have hyperkeratotic, flaky skin, and exhibit loss of the posterior pituitary and disruption of late endocrine hypothalamic development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Ankef1 A T 2: 136,550,158 K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aqp6 A T 15: 99,604,307 *294C probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Bcl2l14 A G 6: 134,427,302 D151G probably damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Clhc1 A G 11: 29,553,725 D47G probably damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Fth1 A G 19: 9,984,853 T154A probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nepn A T 10: 52,400,416 T22S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pard3b A T 1: 62,166,367 D440V probably damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Pou3f2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02325:Pou3f2 APN 4 22487020 missense probably damaging 1.00
PIT4260001:Pou3f2 UTSW 4 22487291 missense possibly damaging 0.59
R0141:Pou3f2 UTSW 4 22487210 missense possibly damaging 0.91
R0739:Pou3f2 UTSW 4 22486960 missense possibly damaging 0.88
R1054:Pou3f2 UTSW 4 22487536 missense possibly damaging 0.85
R1163:Pou3f2 UTSW 4 22487697 small deletion probably benign
R1351:Pou3f2 UTSW 4 22487162 missense probably damaging 0.99
R1708:Pou3f2 UTSW 4 22487255 missense possibly damaging 0.85
R1865:Pou3f2 UTSW 4 22486917 nonsense probably null
R1918:Pou3f2 UTSW 4 22487119 missense probably damaging 0.98
R1919:Pou3f2 UTSW 4 22487119 missense probably damaging 0.98
R2071:Pou3f2 UTSW 4 22488076 missense probably benign 0.07
R4985:Pou3f2 UTSW 4 22487588 missense probably benign 0.26
R5210:Pou3f2 UTSW 4 22487324 missense probably damaging 1.00
R6174:Pou3f2 UTSW 4 22486960 missense possibly damaging 0.88
R7134:Pou3f2 UTSW 4 22486874 missense probably benign 0.00
R7197:Pou3f2 UTSW 4 22487288 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCCCAGGAAAGACTGTGGACCAAAG -3'
(R):5'- TGGAAGAGGCAGACTCATCCTCGG -3'

Sequencing Primer
(F):5'- GAGCCCCAAGCTCTGCC -3'
(R):5'- ACTCATCCTCGGGCAGC -3'
Posted On 2014-03-28