Mutagenetix > Incidental Mutations

Incidental Mutation 'R1482:Pou3f2'

164431

Institutional Source

Beutler Lab

Gene Symbol

Pou3f2

Ensembl Gene

ENSMUSG00000095139

Gene Name

POU domain, class 3, transcription factor 2

Synonyms

Otf7, Brn-2, Brn2, A230098E07Rik, 9430075J19Rik

MMRRC Submission

039535-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1482 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

22482780-22488366 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 22486960 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 391 (D391A)

Ref Sequence

ENSEMBL: ENSMUSP00000136147 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000178174]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000178174
AA Change: D391A

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000136147
Gene: ENSMUSG00000095139
AA Change: D391A

Domain	Start	End	E-Value	Type
coiled coil region	122	152	N/A	INTRINSIC
low complexity region	158	169	N/A	INTRINSIC
low complexity region	220	261	N/A	INTRINSIC
POU	264	338	9.06e-54	SMART
HOX	356	418	4.2e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203909

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 83.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POU-III class of neural transcription factors. The encoded protein is involved in neuronal differentiation and enhances the activation of corticotropin-releasing hormone regulated genes. Overexpression of this protein is associated with an increase in the proliferation of melanoma cells. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous mutation of this gene results in lethality by 10 days of age. Mutant animals are growth retarded, have hyperkeratotic, flaky skin, and exhibit loss of the posterior pituitary and disruption of late endocrine hypothalamic development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	G	A	19: 3,717,192	D260N	probably benign	Het
AI314180	T	C	4: 58,820,163	K1217E	possibly damaging	Het
Ankef1	A	T	2: 136,550,158	K422N	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Aqp6	A	T	15: 99,604,307	*294C	probably null	Het
Baz2a	T	A	10: 128,109,008	M38K	possibly damaging	Het
Bcl2l14	A	G	6: 134,427,302	D151G	probably damaging	Het
Cabp5	T	A	7: 13,398,342	L12*	probably null	Het
Cachd1	T	C	4: 100,988,598	V993A	possibly damaging	Het
Cd44	G	A	2: 102,831,383	T306I	probably damaging	Het
Cdc20	A	T	4: 118,437,056	N22K	probably benign	Het
Cdc6	T	A	11: 98,916,981	D433E	possibly damaging	Het
Clhc1	A	G	11: 29,553,725	D47G	probably damaging	Het
Csf2	T	C	11: 54,248,563	K65E	probably benign	Het
Cul9	T	C	17: 46,508,547	E2005G	probably damaging	Het
Dclk3	G	T	9: 111,467,820	R144L	possibly damaging	Het
Dcpp2	C	T	17: 23,900,542	T110I	probably damaging	Het
Disp1	A	T	1: 183,086,474	F1461I	possibly damaging	Het
Dnah1	C	T	14: 31,294,874	G1562D	probably damaging	Het
Exoc3l2	C	A	7: 19,495,359	P234Q	probably damaging	Het
F2rl2	T	C	13: 95,701,539	V364A	probably benign	Het
Fam151a	T	C	4: 106,745,679	L265P	probably damaging	Het
Fam151b	T	A	13: 92,450,166	Q253L	probably benign	Het
Fat1	G	A	8: 44,953,244	V1011M	probably benign	Het
Fbxo6	G	A	4: 148,145,984	R274*	probably null	Het
Fgd4	G	T	16: 16,484,473	Q73K	probably benign	Het
Fth1	A	G	19: 9,984,853	T154A	probably benign	Het
Hgs	C	A	11: 120,480,040	H572Q	probably benign	Het
Kcnk10	G	A	12: 98,489,948	T208I	probably damaging	Het
Kdm5b	G	A	1: 134,624,897	V1204M	probably damaging	Het
Keg1	A	C	19: 12,718,821	H166P	probably damaging	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Llcfc1	A	T	6: 41,685,284	D74V	probably damaging	Het
Lman2	A	G	13: 55,351,405	V219A	possibly damaging	Het
Mettl25	A	G	10: 105,826,590	I173T	possibly damaging	Het
Mov10	G	T	3: 104,804,546	P170Q	probably damaging	Het
Mtif2	G	T	11: 29,536,847	A286S	probably damaging	Het
Mtmr10	A	G	7: 64,314,249	Y244C	probably damaging	Het
Nbea	A	T	3: 56,079,993	C359S	probably damaging	Het
Nbr1	C	T	11: 101,572,841	T633I	probably benign	Het
Nepn	A	T	10: 52,400,416	T22S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Oacyl	T	A	18: 65,737,972	L342M	probably damaging	Het
Olfr691	T	A	7: 105,337,256	R153S	probably damaging	Het
Olfr699	A	G	7: 106,790,333	F223L	probably benign	Het
Olfr775	T	A	10: 129,251,143	I203N	possibly damaging	Het
Olfr872	G	A	9: 20,260,724	V295I	possibly damaging	Het
Oxnad1	T	C	14: 32,099,633		probably null	Het
Pard3b	A	T	1: 62,166,367	D440V	probably damaging	Het
Ptprk	T	C	10: 28,263,516	V79A	probably benign	Het
Rwdd2a	A	G	9: 86,574,278	D169G	probably damaging	Het
Scn3b	A	C	9: 40,279,496	D74A	probably damaging	Het
Setbp1	C	T	18: 79,086,835	D61N	probably damaging	Het
Setx	T	A	2: 29,162,992	D2089E	probably damaging	Het
Vmn2r69	C	G	7: 85,406,874	W685C	probably damaging	Het
Vps8	A	G	16: 21,581,598	Q1272R	probably benign	Het
Wnk4	T	C	11: 101,269,636	F699L	probably damaging	Het
Zfp616	T	A	11: 74,083,977	N448K	possibly damaging	Het
Zfp618	C	A	4: 63,115,448	D307E	possibly damaging	Het
Zfp687	A	G	3: 95,007,533	F1219S	probably damaging	Het
Zfpm2	T	A	15: 41,099,291	D248E	probably damaging	Het

Other mutations in Pou3f2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02325:Pou3f2	APN	4	22487020	missense	probably damaging	1.00
PIT4260001:Pou3f2	UTSW	4	22487291	missense	possibly damaging	0.59
R0141:Pou3f2	UTSW	4	22487210	missense	possibly damaging	0.91
R0739:Pou3f2	UTSW	4	22486960	missense	possibly damaging	0.88
R1054:Pou3f2	UTSW	4	22487536	missense	possibly damaging	0.85
R1163:Pou3f2	UTSW	4	22487697	small deletion	probably benign
R1351:Pou3f2	UTSW	4	22487162	missense	probably damaging	0.99
R1708:Pou3f2	UTSW	4	22487255	missense	possibly damaging	0.85
R1865:Pou3f2	UTSW	4	22486917	nonsense	probably null
R1918:Pou3f2	UTSW	4	22487119	missense	probably damaging	0.98
R1919:Pou3f2	UTSW	4	22487119	missense	probably damaging	0.98
R2071:Pou3f2	UTSW	4	22488076	missense	probably benign	0.07
R4985:Pou3f2	UTSW	4	22487588	missense	probably benign	0.26
R5210:Pou3f2	UTSW	4	22487324	missense	probably damaging	1.00
R6174:Pou3f2	UTSW	4	22486960	missense	possibly damaging	0.88
R7134:Pou3f2	UTSW	4	22486874	missense	probably benign	0.00
R7197:Pou3f2	UTSW	4	22487288	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCCCAGGAAAGACTGTGGACCAAAG -3'
(R):5'- TGGAAGAGGCAGACTCATCCTCGG -3'

Sequencing Primer
(F):5'- GAGCCCCAAGCTCTGCC -3'
(R):5'- ACTCATCCTCGGGCAGC -3'

Posted On

2014-03-28