Incidental Mutation 'R1482:Nepn'
ID 164456
Institutional Source Beutler Lab
Gene Symbol Nepn
Ensembl Gene ENSMUSG00000038624
Gene Name nephrocan
Synonyms periolin, 5730521E12Rik, Npn
MMRRC Submission 039535-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1482 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 52388972-52404625 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 52400416 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 22 (T22S)
Ref Sequence ENSEMBL: ENSMUSP00000151395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067085] [ENSMUST00000219730]
AlphaFold Q9CQ76
Predicted Effect possibly damaging
Transcript: ENSMUST00000067085
AA Change: T83S

PolyPhen 2 Score 0.926 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070130
Gene: ENSMUSG00000038624
AA Change: T83S

signal peptide 1 19 N/A INTRINSIC
LRRNT 20 51 1.11e1 SMART
LRR 94 117 7.79e0 SMART
LRR 139 162 2.67e-1 SMART
LRR 163 183 3.27e2 SMART
LRR 185 208 5.72e-1 SMART
LRR 209 232 5.88e0 SMART
LRR 254 275 2.47e1 SMART
LRR_TYP 276 299 4.4e-2 SMART
LRR 321 344 2.84e1 SMART
low complexity region 346 360 N/A INTRINSIC
LRR_TYP 390 413 6.23e-2 SMART
Blast:LRRCT 425 474 3e-28 BLAST
low complexity region 480 497 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160539
AA Change: T22S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124257
Gene: ENSMUSG00000038624
AA Change: T22S

LRR 33 56 7.79e0 SMART
LRR 78 101 2.67e-1 SMART
LRR 102 122 3.27e2 SMART
LRR 124 147 5.72e-1 SMART
LRR 148 171 5.88e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000219730
AA Change: T22S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Ankef1 A T 2: 136,550,158 K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aqp6 A T 15: 99,604,307 *294C probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Bcl2l14 A G 6: 134,427,302 D151G probably damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Clhc1 A G 11: 29,553,725 D47G probably damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Fth1 A G 19: 9,984,853 T154A probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pard3b A T 1: 62,166,367 D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 D391A possibly damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Nepn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Nepn APN 10 52391815 missense probably damaging 1.00
IGL01731:Nepn APN 10 52400564 missense probably benign 0.00
R0099:Nepn UTSW 10 52401085 missense probably damaging 0.96
R0123:Nepn UTSW 10 52400437 missense probably damaging 0.96
R0134:Nepn UTSW 10 52400437 missense probably damaging 0.96
R0225:Nepn UTSW 10 52400437 missense probably damaging 0.96
R0613:Nepn UTSW 10 52401257 missense probably damaging 1.00
R2969:Nepn UTSW 10 52400887 nonsense probably null
R3731:Nepn UTSW 10 52404014 missense probably damaging 1.00
R3790:Nepn UTSW 10 52400530 missense probably damaging 1.00
R3958:Nepn UTSW 10 52400708 missense probably benign
R4423:Nepn UTSW 10 52391815 missense probably damaging 1.00
R5002:Nepn UTSW 10 52391754 missense probably benign
R5294:Nepn UTSW 10 52400800 missense probably benign 0.02
R5580:Nepn UTSW 10 52404302 missense probably damaging 0.98
R5607:Nepn UTSW 10 52401137 missense probably benign 0.10
R5986:Nepn UTSW 10 52404072 missense probably damaging 1.00
R7135:Nepn UTSW 10 52391719 missense probably damaging 1.00
R7256:Nepn UTSW 10 52400993 missense probably benign 0.01
R7713:Nepn UTSW 10 52401178 missense probably benign 0.16
R8213:Nepn UTSW 10 52391759 missense probably benign 0.00
R8432:Nepn UTSW 10 52391784 missense probably benign 0.15
R8463:Nepn UTSW 10 52400800 missense probably benign 0.23
R9315:Nepn UTSW 10 52391773 missense probably benign 0.02
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- TGTATGGGtgtttgtttgtttgtttg -3'
(R):5'- ttcaagttcttcagtccttcaaactc -3'
Posted On 2014-03-28