Incidental Mutation 'R1482:Clhc1'
ID164461
Institutional Source Beutler Lab
Gene Symbol Clhc1
Ensembl Gene ENSMUSG00000020461
Gene Nameclathrin heavy chain linker domain containing 1
Synonyms1700034F02Rik
MMRRC Submission 039535-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R1482 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29547950-29578367 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29553725 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 47 (D47G)
Ref Sequence ENSEMBL: ENSMUSP00000147007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020753] [ENSMUST00000208530]
Predicted Effect probably damaging
Transcript: ENSMUST00000020753
AA Change: D47G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020753
Gene: ENSMUSG00000020461
AA Change: D47G

DomainStartEndE-ValueType
Pfam:TSNAXIP1_N 28 152 2.6e-26 PFAM
Pfam:Clathrin_H_link 302 365 3.7e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118692
Predicted Effect probably damaging
Transcript: ENSMUST00000208530
AA Change: D47G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Ankef1 A T 2: 136,550,158 K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aqp6 A T 15: 99,604,307 *294C probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Bcl2l14 A G 6: 134,427,302 D151G probably damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Fth1 A G 19: 9,984,853 T154A probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nepn A T 10: 52,400,416 T22S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pard3b A T 1: 62,166,367 D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 D391A possibly damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Clhc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Clhc1 APN 11 29571745 missense probably damaging 0.99
IGL00976:Clhc1 APN 11 29561389 missense probably benign 0.43
IGL01826:Clhc1 APN 11 29553765 splice site probably null
IGL02029:Clhc1 APN 11 29560798 missense probably benign 0.01
IGL02479:Clhc1 APN 11 29578107 missense probably damaging 0.98
R0553:Clhc1 UTSW 11 29561366 splice site probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1313:Clhc1 UTSW 11 29571678 missense probably benign
R1624:Clhc1 UTSW 11 29569287 missense possibly damaging 0.85
R1742:Clhc1 UTSW 11 29557647 splice site probably null
R2094:Clhc1 UTSW 11 29557771 missense probably benign 0.13
R2130:Clhc1 UTSW 11 29557663 missense probably benign 0.33
R2237:Clhc1 UTSW 11 29569329 missense probably benign 0.30
R3814:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R3854:Clhc1 UTSW 11 29571789 missense probably damaging 1.00
R4417:Clhc1 UTSW 11 29571826 missense possibly damaging 0.57
R4659:Clhc1 UTSW 11 29578229 makesense probably null
R5021:Clhc1 UTSW 11 29560627 missense probably benign 0.01
R5246:Clhc1 UTSW 11 29575434 missense probably damaging 1.00
R5287:Clhc1 UTSW 11 29578244 utr 3 prime probably benign
R5657:Clhc1 UTSW 11 29561431 missense probably benign 0.03
R5771:Clhc1 UTSW 11 29563854 missense possibly damaging 0.94
R6050:Clhc1 UTSW 11 29561397 missense possibly damaging 0.76
R6211:Clhc1 UTSW 11 29578145 missense probably damaging 1.00
R6500:Clhc1 UTSW 11 29560542 missense possibly damaging 0.87
R6615:Clhc1 UTSW 11 29578149 missense possibly damaging 0.75
R6944:Clhc1 UTSW 11 29569346 missense probably damaging 0.97
R7252:Clhc1 UTSW 11 29563937 missense probably benign 0.01
R7860:Clhc1 UTSW 11 29557651 critical splice acceptor site probably null
R8221:Clhc1 UTSW 11 29553751 missense possibly damaging 0.95
R8259:Clhc1 UTSW 11 29553746 missense probably benign 0.37
R8769:Clhc1 UTSW 11 29561401 missense probably damaging 0.99
X0023:Clhc1 UTSW 11 29569305 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCTTTGGCTTTATGGCAAAAGAAGG -3'
(R):5'- CCAGAGGGTACAAACCAGTTATTGGG -3'

Sequencing Primer
(F):5'- GAAGGTCAAGGTTTAATTTTTCTCCG -3'
(R):5'- CTAGCCTAACTAGTCATCAGGAAATG -3'
Posted On2014-03-28