Mutagenetix > Incidental Mutation

Incidental Mutation 'R1482:Dnah1'

164476

Institutional Source

Beutler Lab

Gene Symbol

Dnah1

Ensembl Gene

ENSMUSG00000019027

Gene Name

dynein, axonemal, heavy chain 1

Synonyms

E030034C22Rik, MDHC7, Dnahc1, B230373P09Rik

MMRRC Submission

039535-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1482 (G1)

Quality Score

120

Status

Not validated

Chromosome

Chromosomal Location

31260375-31323896 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 31294874 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 1562 (G1562D)

Ref Sequence

ENSEMBL: ENSMUSP00000043281 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048603]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000048603
AA Change: G1562D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: G1562D

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DHC_N2	998	1404	6.3e-146	PFAM
AAA	1558	1697	6.02e-1	SMART
AAA	1839	2077	4.66e0	SMART
low complexity region	2149	2157	N/A	INTRINSIC
AAA	2204	2353	2.35e-1	SMART
Pfam:AAA_8	2533	2803	7.7e-84	PFAM
Pfam:MT	2815	3165	9.9e-57	PFAM
Pfam:AAA_9	3185	3410	1.1e-93	PFAM
Pfam:Dynein_heavy	3545	4246	2.7e-275	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228755

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228927

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 83.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	G	A	19: 3,717,192	D260N	probably benign	Het
AI314180	T	C	4: 58,820,163	K1217E	possibly damaging	Het
Ankef1	A	T	2: 136,550,158	K422N	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Aqp6	A	T	15: 99,604,307	*294C	probably null	Het
Baz2a	T	A	10: 128,109,008	M38K	possibly damaging	Het
Bcl2l14	A	G	6: 134,427,302	D151G	probably damaging	Het
Cabp5	T	A	7: 13,398,342	L12*	probably null	Het
Cachd1	T	C	4: 100,988,598	V993A	possibly damaging	Het
Cd44	G	A	2: 102,831,383	T306I	probably damaging	Het
Cdc20	A	T	4: 118,437,056	N22K	probably benign	Het
Cdc6	T	A	11: 98,916,981	D433E	possibly damaging	Het
Clhc1	A	G	11: 29,553,725	D47G	probably damaging	Het
Csf2	T	C	11: 54,248,563	K65E	probably benign	Het
Cul9	T	C	17: 46,508,547	E2005G	probably damaging	Het
Dclk3	G	T	9: 111,467,820	R144L	possibly damaging	Het
Dcpp2	C	T	17: 23,900,542	T110I	probably damaging	Het
Disp1	A	T	1: 183,086,474	F1461I	possibly damaging	Het
Exoc3l2	C	A	7: 19,495,359	P234Q	probably damaging	Het
F2rl2	T	C	13: 95,701,539	V364A	probably benign	Het
Fam151a	T	C	4: 106,745,679	L265P	probably damaging	Het
Fam151b	T	A	13: 92,450,166	Q253L	probably benign	Het
Fat1	G	A	8: 44,953,244	V1011M	probably benign	Het
Fbxo6	G	A	4: 148,145,984	R274*	probably null	Het
Fgd4	G	T	16: 16,484,473	Q73K	probably benign	Het
Fth1	A	G	19: 9,984,853	T154A	probably benign	Het
Hgs	C	A	11: 120,480,040	H572Q	probably benign	Het
Kcnk10	G	A	12: 98,489,948	T208I	probably damaging	Het
Kdm5b	G	A	1: 134,624,897	V1204M	probably damaging	Het
Keg1	A	C	19: 12,718,821	H166P	probably damaging	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Llcfc1	A	T	6: 41,685,284	D74V	probably damaging	Het
Lman2	A	G	13: 55,351,405	V219A	possibly damaging	Het
Mettl25	A	G	10: 105,826,590	I173T	possibly damaging	Het
Mov10	G	T	3: 104,804,546	P170Q	probably damaging	Het
Mtif2	G	T	11: 29,536,847	A286S	probably damaging	Het
Mtmr10	A	G	7: 64,314,249	Y244C	probably damaging	Het
Nbea	A	T	3: 56,079,993	C359S	probably damaging	Het
Nbr1	C	T	11: 101,572,841	T633I	probably benign	Het
Nepn	A	T	10: 52,400,416	T22S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Oacyl	T	A	18: 65,737,972	L342M	probably damaging	Het
Olfr691	T	A	7: 105,337,256	R153S	probably damaging	Het
Olfr699	A	G	7: 106,790,333	F223L	probably benign	Het
Olfr775	T	A	10: 129,251,143	I203N	possibly damaging	Het
Olfr872	G	A	9: 20,260,724	V295I	possibly damaging	Het
Oxnad1	T	C	14: 32,099,633		probably null	Het
Pard3b	A	T	1: 62,166,367	D440V	probably damaging	Het
Pou3f2	T	G	4: 22,486,960	D391A	possibly damaging	Het
Ptprk	T	C	10: 28,263,516	V79A	probably benign	Het
Rwdd2a	A	G	9: 86,574,278	D169G	probably damaging	Het
Scn3b	A	C	9: 40,279,496	D74A	probably damaging	Het
Setbp1	C	T	18: 79,086,835	D61N	probably damaging	Het
Setx	T	A	2: 29,162,992	D2089E	probably damaging	Het
Vmn2r69	C	G	7: 85,406,874	W685C	probably damaging	Het
Vps8	A	G	16: 21,581,598	Q1272R	probably benign	Het
Wnk4	T	C	11: 101,269,636	F699L	probably damaging	Het
Zfp616	T	A	11: 74,083,977	N448K	possibly damaging	Het
Zfp618	C	A	4: 63,115,448	D307E	possibly damaging	Het
Zfp687	A	G	3: 95,007,533	F1219S	probably damaging	Het
Zfpm2	T	A	15: 41,099,291	D248E	probably damaging	Het

Other mutations in Dnah1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Dnah1	APN	14	31287873	missense	probably benign	0.01
IGL00227:Dnah1	APN	14	31286896	missense	probably damaging	1.00
IGL00491:Dnah1	APN	14	31261839	missense	probably damaging	1.00
IGL00787:Dnah1	APN	14	31300063	missense	possibly damaging	0.91
IGL00809:Dnah1	APN	14	31300809	nonsense	probably null
IGL00911:Dnah1	APN	14	31304434	splice site	probably null
IGL00949:Dnah1	APN	14	31307090	missense	probably benign	0.00
IGL00976:Dnah1	APN	14	31278138	missense	probably damaging	1.00
IGL01484:Dnah1	APN	14	31299940	missense	probably damaging	0.98
IGL01629:Dnah1	APN	14	31292320	missense	probably damaging	1.00
IGL01716:Dnah1	APN	14	31263378	missense	probably benign	0.34
IGL01893:Dnah1	APN	14	31266470	missense	probably damaging	1.00
IGL01933:Dnah1	APN	14	31310915	missense	probably benign	0.40
IGL01938:Dnah1	APN	14	31283887	missense	probably benign
IGL02032:Dnah1	APN	14	31274369	missense	probably benign
IGL02052:Dnah1	APN	14	31268786	missense	probably damaging	0.99
IGL02097:Dnah1	APN	14	31305001	missense	possibly damaging	0.92
IGL02127:Dnah1	APN	14	31304928	missense	probably benign	0.00
IGL02143:Dnah1	APN	14	31283289	missense	probably damaging	1.00
IGL02158:Dnah1	APN	14	31300967	missense	probably benign	0.00
IGL02442:Dnah1	APN	14	31287878	missense	probably damaging	1.00
IGL02525:Dnah1	APN	14	31305833	missense	probably benign	0.05
IGL02558:Dnah1	APN	14	31274379	missense	possibly damaging	0.96
IGL02633:Dnah1	APN	14	31284815	missense	probably benign	0.05
IGL02720:Dnah1	APN	14	31262220	missense	probably damaging	0.96
IGL02728:Dnah1	APN	14	31283998	missense	probably benign	0.44
IGL02738:Dnah1	APN	14	31292640	missense	probably benign	0.27
IGL02863:Dnah1	APN	14	31295293	missense	probably damaging	0.99
IGL02944:Dnah1	APN	14	31300871	missense	possibly damaging	0.88
IGL03110:Dnah1	APN	14	31266717	missense	probably benign	0.40
IGL03201:Dnah1	APN	14	31300949	missense	probably benign	0.13
IGL03215:Dnah1	APN	14	31274391	missense	probably damaging	1.00
IGL03230:Dnah1	APN	14	31270066	missense	probably damaging	1.00
IGL03248:Dnah1	APN	14	31269889	missense	probably damaging	1.00
IGL03267:Dnah1	APN	14	31286588	missense	probably benign	0.00
IGL03299:Dnah1	APN	14	31315122	nonsense	probably null
IGL03301:Dnah1	APN	14	31292692	missense	probably damaging	1.00
ergonomic	UTSW	14	31300748	missense	possibly damaging	0.91
Faraday	UTSW	14	31310882	missense	probably null	0.05
K3955:Dnah1	UTSW	14	31266459	missense	probably benign
PIT1430001:Dnah1	UTSW	14	31262580	missense	probably damaging	1.00
PIT4382001:Dnah1	UTSW	14	31284455	missense	probably damaging	1.00
R0043:Dnah1	UTSW	14	31274405	missense	probably damaging	0.97
R0092:Dnah1	UTSW	14	31271609	missense	probably benign	0.00
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0100:Dnah1	UTSW	14	31262152	critical splice donor site	probably null
R0101:Dnah1	UTSW	14	31283899	missense	probably damaging	1.00
R0119:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0136:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0144:Dnah1	UTSW	14	31267874	splice site	probably benign
R0279:Dnah1	UTSW	14	31302375	missense	possibly damaging	0.94
R0299:Dnah1	UTSW	14	31276158	missense	probably damaging	1.00
R0316:Dnah1	UTSW	14	31278151	missense	probably benign	0.00
R0739:Dnah1	UTSW	14	31265915	nonsense	probably null
R0789:Dnah1	UTSW	14	31304591	missense	probably benign
R0826:Dnah1	UTSW	14	31303907	missense	probably benign	0.02
R1102:Dnah1	UTSW	14	31296457	nonsense	probably null
R1116:Dnah1	UTSW	14	31307867	missense	probably benign	0.13
R1229:Dnah1	UTSW	14	31310851	missense	probably benign	0.11
R1447:Dnah1	UTSW	14	31306898	missense	probably benign	0.06
R1449:Dnah1	UTSW	14	31263951	missense	probably damaging	1.00
R1462:Dnah1	UTSW	14	31268781	splice site	probably benign
R1500:Dnah1	UTSW	14	31316758	missense	probably benign
R1512:Dnah1	UTSW	14	31293037	missense	probably damaging	1.00
R1591:Dnah1	UTSW	14	31272332	missense	probably benign	0.01
R1598:Dnah1	UTSW	14	31301262	missense	probably benign	0.07
R1644:Dnah1	UTSW	14	31302292	splice site	probably benign
R1672:Dnah1	UTSW	14	31276200	missense	probably damaging	1.00
R1713:Dnah1	UTSW	14	31279182	missense	probably damaging	1.00
R1769:Dnah1	UTSW	14	31310882	missense	probably null	0.05
R1796:Dnah1	UTSW	14	31261093	missense	probably benign	0.00
R1902:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1903:Dnah1	UTSW	14	31319759	missense	probably damaging	0.99
R1905:Dnah1	UTSW	14	31264630	missense	probably benign	0.06
R1908:Dnah1	UTSW	14	31262558	missense	probably damaging	1.00
R1972:Dnah1	UTSW	14	31265391	nonsense	probably null
R1973:Dnah1	UTSW	14	31265391	nonsense	probably null
R2004:Dnah1	UTSW	14	31301856	missense	possibly damaging	0.79
R2051:Dnah1	UTSW	14	31279123	missense	probably damaging	1.00
R2062:Dnah1	UTSW	14	31271129	missense	probably damaging	1.00
R2188:Dnah1	UTSW	14	31279164	missense	probably damaging	0.98
R2240:Dnah1	UTSW	14	31299974	missense	probably benign	0.00
R2862:Dnah1	UTSW	14	31284762	missense	probably benign	0.21
R2894:Dnah1	UTSW	14	31298761	missense	possibly damaging	0.67
R3120:Dnah1	UTSW	14	31266822	nonsense	probably null
R3410:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3411:Dnah1	UTSW	14	31269817	missense	possibly damaging	0.55
R3435:Dnah1	UTSW	14	31316674	missense	probably damaging	0.96
R3615:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3616:Dnah1	UTSW	14	31315148	missense	possibly damaging	0.92
R3741:Dnah1	UTSW	14	31265467	splice site	probably benign
R3805:Dnah1	UTSW	14	31294763	missense	possibly damaging	0.67
R3894:Dnah1	UTSW	14	31307028	missense	probably benign
R4007:Dnah1	UTSW	14	31303784	splice site	probably benign
R4201:Dnah1	UTSW	14	31262270	missense	probably benign	0.00
R4232:Dnah1	UTSW	14	31304916	missense	probably benign
R4372:Dnah1	UTSW	14	31304922	missense	probably damaging	1.00
R4391:Dnah1	UTSW	14	31294835	missense	probably damaging	1.00
R4423:Dnah1	UTSW	14	31284761	missense	probably benign	0.00
R4526:Dnah1	UTSW	14	31285998	missense	probably benign	0.05
R4650:Dnah1	UTSW	14	31284887	splice site	probably null
R4723:Dnah1	UTSW	14	31272942	missense	probably damaging	1.00
R4748:Dnah1	UTSW	14	31319945	missense	probably benign
R4783:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4784:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4785:Dnah1	UTSW	14	31263479	missense	probably damaging	1.00
R4843:Dnah1	UTSW	14	31264963	missense	probably damaging	1.00
R4879:Dnah1	UTSW	14	31300748	missense	possibly damaging	0.91
R4897:Dnah1	UTSW	14	31267539	missense	probably damaging	1.00
R4911:Dnah1	UTSW	14	31295323	missense	probably damaging	1.00
R4985:Dnah1	UTSW	14	31286898	missense	probably null	1.00
R5070:Dnah1	UTSW	14	31282418	missense	probably benign	0.05
R5128:Dnah1	UTSW	14	31296195	splice site	probably null
R5409:Dnah1	UTSW	14	31263255	missense	probably damaging	1.00
R5436:Dnah1	UTSW	14	31316747	missense	probably benign
R5481:Dnah1	UTSW	14	31308871	missense	possibly damaging	0.55
R5550:Dnah1	UTSW	14	31316708	missense	probably benign	0.00
R5555:Dnah1	UTSW	14	31290819	missense	probably damaging	0.99
R5566:Dnah1	UTSW	14	31274366	missense	probably benign	0.35
R5623:Dnah1	UTSW	14	31286023	missense	possibly damaging	0.62
R5701:Dnah1	UTSW	14	31274044	missense	probably damaging	1.00
R5751:Dnah1	UTSW	14	31310906	missense	probably benign	0.00
R5823:Dnah1	UTSW	14	31266418	missense	possibly damaging	0.92
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6030:Dnah1	UTSW	14	31268027	missense	probably damaging	1.00
R6090:Dnah1	UTSW	14	31269425	missense	possibly damaging	0.83
R6139:Dnah1	UTSW	14	31286027	missense	probably benign	0.02
R6145:Dnah1	UTSW	14	31300970	missense	probably benign	0.07
R6306:Dnah1	UTSW	14	31304587	missense	probably damaging	0.97
R6376:Dnah1	UTSW	14	31275608	missense	probably damaging	1.00
R6451:Dnah1	UTSW	14	31300808	missense	probably benign	0.08
R6549:Dnah1	UTSW	14	31269383	missense	probably damaging	1.00
R6748:Dnah1	UTSW	14	31299988	missense	probably damaging	0.99
R6826:Dnah1	UTSW	14	31286290	missense	probably benign	0.00
R6870:Dnah1	UTSW	14	31271061	nonsense	probably null
R6932:Dnah1	UTSW	14	31287776	missense	probably damaging	1.00
R6944:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R7033:Dnah1	UTSW	14	31264925	missense	probably damaging	1.00
R7078:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R7133:Dnah1	UTSW	14	31286076	missense	probably benign
R7136:Dnah1	UTSW	14	31298656	missense	probably damaging	1.00
R7203:Dnah1	UTSW	14	31274382	missense	probably benign
R7241:Dnah1	UTSW	14	31264939	missense	probably benign	0.00
R7260:Dnah1	UTSW	14	31269386	missense	probably damaging	1.00
R7264:Dnah1	UTSW	14	31269894	missense	probably benign
R7291:Dnah1	UTSW	14	31298705	missense	probably damaging	1.00
R7293:Dnah1	UTSW	14	31287863	missense	probably damaging	1.00
R7300:Dnah1	UTSW	14	31269841	missense	probably benign	0.05
R7319:Dnah1	UTSW	14	31296594	missense	probably benign	0.02
R7323:Dnah1	UTSW	14	31298707	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31261590	missense	probably damaging	1.00
R7472:Dnah1	UTSW	14	31300791	missense	possibly damaging	0.80
R7499:Dnah1	UTSW	14	31315122	nonsense	probably null
R7526:Dnah1	UTSW	14	31287876	missense	possibly damaging	0.49
R7560:Dnah1	UTSW	14	31304983	missense	probably benign
R7574:Dnah1	UTSW	14	31319908	missense	probably benign	0.00
R7617:Dnah1	UTSW	14	31284782	missense	possibly damaging	0.80
R7620:Dnah1	UTSW	14	31303906	missense	possibly damaging	0.47
R7692:Dnah1	UTSW	14	31292338	missense	probably benign	0.00
R7702:Dnah1	UTSW	14	31310909	missense	probably benign
R7786:Dnah1	UTSW	14	31262521	missense	probably damaging	1.00
R7984:Dnah1	UTSW	14	31267815	missense	probably damaging	1.00
R8002:Dnah1	UTSW	14	31298722	missense	probably damaging	1.00
R8022:Dnah1	UTSW	14	31265014	missense	probably damaging	1.00
R8032:Dnah1	UTSW	14	31271548	missense	probably damaging	1.00
R8099:Dnah1	UTSW	14	31302364	missense	probably benign	0.00
R8171:Dnah1	UTSW	14	31297110	missense	probably damaging	1.00
R8263:Dnah1	UTSW	14	31293177	missense	probably damaging	1.00
R8274:Dnah1	UTSW	14	31295574	missense	probably benign	0.00
R8345:Dnah1	UTSW	14	31264594	missense	probably damaging	1.00
R8348:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8353:Dnah1	UTSW	14	31283202	missense	probably benign
R8356:Dnah1	UTSW	14	31273015	missense	probably benign	0.00
R8376:Dnah1	UTSW	14	31301346	missense	probably damaging	1.00
R8448:Dnah1	UTSW	14	31293725	missense	probably damaging	1.00
R8461:Dnah1	UTSW	14	31305958	missense	probably benign	0.00
R8534:Dnah1	UTSW	14	31301848	missense	probably benign	0.16
R8544:Dnah1	UTSW	14	31268904	missense	probably damaging	1.00
R8679:Dnah1	UTSW	14	31267810	missense	possibly damaging	0.77
R8716:Dnah1	UTSW	14	31267984	critical splice donor site	probably benign
R8750:Dnah1	UTSW	14	31304967	missense	probably benign	0.30
R8790:Dnah1	UTSW	14	31296275	missense	possibly damaging	0.89
R8808:Dnah1	UTSW	14	31286814	missense	probably benign
R8821:Dnah1	UTSW	14	31296498	missense	probably benign
R8887:Dnah1	UTSW	14	31311040	missense	probably damaging	1.00
R8948:Dnah1	UTSW	14	31290439	missense	probably damaging	1.00
R8950:Dnah1	UTSW	14	31290439	missense	probably damaging	1.00
R8955:Dnah1	UTSW	14	31285993	missense	probably benign
R8987:Dnah1	UTSW	14	31311747	missense	possibly damaging	0.93
R8998:Dnah1	UTSW	14	31296278	missense	probably benign	0.12
R8999:Dnah1	UTSW	14	31296278	missense	probably benign	0.12
R9015:Dnah1	UTSW	14	31264359	missense	probably damaging	0.96
R9031:Dnah1	UTSW	14	31279171	missense	probably benign
R9088:Dnah1	UTSW	14	31266013	missense	probably benign	0.04
R9096:Dnah1	UTSW	14	31261070	missense	probably damaging	0.99
R9117:Dnah1	UTSW	14	31311624	splice site	probably benign
R9157:Dnah1	UTSW	14	31266013	missense	probably damaging	0.97
R9296:Dnah1	UTSW	14	31274054	critical splice acceptor site	probably null
R9313:Dnah1	UTSW	14	31266013	missense	probably damaging	0.97
R9325:Dnah1	UTSW	14	31276203	missense	possibly damaging	0.69
R9352:Dnah1	UTSW	14	31316663	missense	probably benign	0.00
R9411:Dnah1	UTSW	14	31296299	missense	probably damaging	1.00
R9429:Dnah1	UTSW	14	31275542	nonsense	probably null
R9452:Dnah1	UTSW	14	31296491	missense	probably benign	0.35
R9562:Dnah1	UTSW	14	31264437	missense	probably damaging	1.00
R9565:Dnah1	UTSW	14	31264437	missense	probably damaging	1.00
R9616:Dnah1	UTSW	14	31304443	missense	probably null	0.20
R9621:Dnah1	UTSW	14	31294815	missense	probably damaging	1.00
R9677:Dnah1	UTSW	14	31307864	missense	probably benign	0.00
R9723:Dnah1	UTSW	14	31265989	missense	probably damaging	1.00
R9758:Dnah1	UTSW	14	31263438	missense	probably damaging	0.98
RF006:Dnah1	UTSW	14	31307875	missense	probably benign	0.08
Z1088:Dnah1	UTSW	14	31304811	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- CCGATAGCACCTCAATGTCGATCC -3'
(R):5'- GCAAGAGCTGCTGATCTACAGAGTC -3'

Sequencing Primer
(F):5'- AAAGCTCTCAGTGGTGATCC -3'
(R):5'- CTGCTGATCTACAGAGTCCTGAAG -3'

Posted On

2014-03-28