Mutagenetix > Incidental Mutation

Incidental Mutation 'R1482:Vps8'

164481

Institutional Source

Beutler Lab

Gene Symbol

Vps8

Ensembl Gene

ENSMUSG00000033653

Gene Name

VPS8 CORVET complex subunit

Synonyms

MMRRC Submission

039535-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R1482 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21423118-21644680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21581598 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 1272 (Q1272R)

Ref Sequence

ENSEMBL: ENSMUSP00000112636 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118138] [ENSMUST00000118923]

AlphaFold

Q0P5W1

Predicted Effect

probably benign
Transcript: ENSMUST00000096191

SMART Domains

Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	7e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.7e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
Blast:RING	1257	1277	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000096192
AA Change: Q1272R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: Q1272R

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	1e-8	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.4e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115397
AA Change: Q1302R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: Q1302R

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	8e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	613	796	1.3e-61	PFAM
low complexity region	994	1009	N/A	INTRINSIC
low complexity region	1087	1099	N/A	INTRINSIC
low complexity region	1128	1139	N/A	INTRINSIC
RING	1259	1310	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000117598
AA Change: Q1300R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: Q1300R

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	8e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.9e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
RING	1257	1308	1.23e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000118138

SMART Domains

Protein: ENSMUSP00000113447
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
Pfam:Vps8	1	76	7.7e-21	PFAM
low complexity region	274	289	N/A	INTRINSIC
low complexity region	367	379	N/A	INTRINSIC
low complexity region	408	419	N/A	INTRINSIC
RING	539	590	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118923
AA Change: Q1272R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: Q1272R

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	9e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.9e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000125487
AA Change: Q870R

SMART Domains

Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653
AA Change: Q870R

Domain	Start	End	E-Value	Type
Pfam:Vps8	182	365	8.5e-62	PFAM
low complexity region	563	578	N/A	INTRINSIC
low complexity region	656	668	N/A	INTRINSIC
low complexity region	697	708	N/A	INTRINSIC
RING	828	879	1.23e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150765

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231484

Coding Region Coverage

1x: 98.8%
3x: 97.7%
10x: 93.8%
20x: 83.6%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810055G02Rik	G	A	19: 3,717,192	D260N	probably benign	Het
AI314180	T	C	4: 58,820,163	K1217E	possibly damaging	Het
Ankef1	A	T	2: 136,550,158	K422N	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Aqp6	A	T	15: 99,604,307	*294C	probably null	Het
Baz2a	T	A	10: 128,109,008	M38K	possibly damaging	Het
Bcl2l14	A	G	6: 134,427,302	D151G	probably damaging	Het
Cabp5	T	A	7: 13,398,342	L12*	probably null	Het
Cachd1	T	C	4: 100,988,598	V993A	possibly damaging	Het
Cd44	G	A	2: 102,831,383	T306I	probably damaging	Het
Cdc20	A	T	4: 118,437,056	N22K	probably benign	Het
Cdc6	T	A	11: 98,916,981	D433E	possibly damaging	Het
Clhc1	A	G	11: 29,553,725	D47G	probably damaging	Het
Csf2	T	C	11: 54,248,563	K65E	probably benign	Het
Cul9	T	C	17: 46,508,547	E2005G	probably damaging	Het
Dclk3	G	T	9: 111,467,820	R144L	possibly damaging	Het
Dcpp2	C	T	17: 23,900,542	T110I	probably damaging	Het
Disp1	A	T	1: 183,086,474	F1461I	possibly damaging	Het
Dnah1	C	T	14: 31,294,874	G1562D	probably damaging	Het
Exoc3l2	C	A	7: 19,495,359	P234Q	probably damaging	Het
F2rl2	T	C	13: 95,701,539	V364A	probably benign	Het
Fam151a	T	C	4: 106,745,679	L265P	probably damaging	Het
Fam151b	T	A	13: 92,450,166	Q253L	probably benign	Het
Fat1	G	A	8: 44,953,244	V1011M	probably benign	Het
Fbxo6	G	A	4: 148,145,984	R274*	probably null	Het
Fgd4	G	T	16: 16,484,473	Q73K	probably benign	Het
Fth1	A	G	19: 9,984,853	T154A	probably benign	Het
Hgs	C	A	11: 120,480,040	H572Q	probably benign	Het
Kcnk10	G	A	12: 98,489,948	T208I	probably damaging	Het
Kdm5b	G	A	1: 134,624,897	V1204M	probably damaging	Het
Keg1	A	C	19: 12,718,821	H166P	probably damaging	Het
Kifap3	A	T	1: 163,825,859	N338I	possibly damaging	Het
Llcfc1	A	T	6: 41,685,284	D74V	probably damaging	Het
Lman2	A	G	13: 55,351,405	V219A	possibly damaging	Het
Mettl25	A	G	10: 105,826,590	I173T	possibly damaging	Het
Mov10	G	T	3: 104,804,546	P170Q	probably damaging	Het
Mtif2	G	T	11: 29,536,847	A286S	probably damaging	Het
Mtmr10	A	G	7: 64,314,249	Y244C	probably damaging	Het
Nbea	A	T	3: 56,079,993	C359S	probably damaging	Het
Nbr1	C	T	11: 101,572,841	T633I	probably benign	Het
Nepn	A	T	10: 52,400,416	T22S	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Oacyl	T	A	18: 65,737,972	L342M	probably damaging	Het
Olfr691	T	A	7: 105,337,256	R153S	probably damaging	Het
Olfr699	A	G	7: 106,790,333	F223L	probably benign	Het
Olfr775	T	A	10: 129,251,143	I203N	possibly damaging	Het
Olfr872	G	A	9: 20,260,724	V295I	possibly damaging	Het
Oxnad1	T	C	14: 32,099,633		probably null	Het
Pard3b	A	T	1: 62,166,367	D440V	probably damaging	Het
Pou3f2	T	G	4: 22,486,960	D391A	possibly damaging	Het
Ptprk	T	C	10: 28,263,516	V79A	probably benign	Het
Rwdd2a	A	G	9: 86,574,278	D169G	probably damaging	Het
Scn3b	A	C	9: 40,279,496	D74A	probably damaging	Het
Setbp1	C	T	18: 79,086,835	D61N	probably damaging	Het
Setx	T	A	2: 29,162,992	D2089E	probably damaging	Het
Vmn2r69	C	G	7: 85,406,874	W685C	probably damaging	Het
Wnk4	T	C	11: 101,269,636	F699L	probably damaging	Het
Zfp616	T	A	11: 74,083,977	N448K	possibly damaging	Het
Zfp618	C	A	4: 63,115,448	D307E	possibly damaging	Het
Zfp687	A	G	3: 95,007,533	F1219S	probably damaging	Het
Zfpm2	T	A	15: 41,099,291	D248E	probably damaging	Het

Other mutations in Vps8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Vps8	APN	16	21442334	missense	possibly damaging	0.47
IGL00596:Vps8	APN	16	21448412	splice site	probably benign
IGL00985:Vps8	APN	16	21477584	splice site	probably benign
IGL01356:Vps8	APN	16	21517357	critical splice donor site	probably null
IGL01375:Vps8	APN	16	21559372	nonsense	probably null
IGL01643:Vps8	APN	16	21518222	missense	possibly damaging	0.92
IGL02159:Vps8	APN	16	21466484	missense	possibly damaging	0.69
IGL02214:Vps8	APN	16	21517285	missense	probably damaging	1.00
IGL02465:Vps8	APN	16	21521903	missense	probably damaging	1.00
IGL02651:Vps8	APN	16	21517336	missense	probably damaging	0.99
IGL03174:Vps8	APN	16	21466463	missense	probably damaging	1.00
IGL03337:Vps8	APN	16	21563168	missense	probably benign
IGL03383:Vps8	APN	16	21435823	critical splice donor site	probably null
IGL03402:Vps8	APN	16	21448398	missense	possibly damaging	0.68
empires	UTSW	16	21581548	nonsense	probably null
porky	UTSW	16	21461238	missense	probably benign	0.32
realm	UTSW	16	21545236	intron	probably benign
realms	UTSW	16	21444188	splice site	probably null
Reich	UTSW	16	21478439	missense	probably benign	0.29
reichen	UTSW	16	21506825	splice site	probably benign
IGL03052:Vps8	UTSW	16	21448365	missense	probably damaging	0.99
PIT4677001:Vps8	UTSW	16	21500334	missense	possibly damaging	0.94
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0125:Vps8	UTSW	16	21470154	missense	probably benign	0.00
R0137:Vps8	UTSW	16	21504386	splice site	probably benign
R0362:Vps8	UTSW	16	21608227	intron	probably benign
R0384:Vps8	UTSW	16	21506825	splice site	probably benign
R0492:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0525:Vps8	UTSW	16	21540109	critical splice donor site	probably null
R0531:Vps8	UTSW	16	21459811	intron	probably benign
R0605:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R0636:Vps8	UTSW	16	21434933	missense	probably benign	0.32
R0707:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0840:Vps8	UTSW	16	21456321	missense	probably damaging	0.99
R1170:Vps8	UTSW	16	21459820	intron	probably benign
R1203:Vps8	UTSW	16	21511557	missense	probably damaging	1.00
R1531:Vps8	UTSW	16	21466476	nonsense	probably null
R1642:Vps8	UTSW	16	21581579	missense	probably benign
R1956:Vps8	UTSW	16	21461142	missense	probably damaging	1.00
R2201:Vps8	UTSW	16	21576757	missense	probably damaging	1.00
R2287:Vps8	UTSW	16	21568413	missense	probably damaging	1.00
R2423:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R3151:Vps8	UTSW	16	21442373	missense	probably benign	0.04
R3943:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R3944:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R4043:Vps8	UTSW	16	21526396	missense	probably damaging	1.00
R4302:Vps8	UTSW	16	21495914	missense	probably damaging	1.00
R4398:Vps8	UTSW	16	21504466	missense	probably damaging	1.00
R4477:Vps8	UTSW	16	21545236	intron	probably benign
R4478:Vps8	UTSW	16	21545236	intron	probably benign
R4479:Vps8	UTSW	16	21545236	intron	probably benign
R4480:Vps8	UTSW	16	21545236	intron	probably benign
R4571:Vps8	UTSW	16	21435775	missense	probably damaging	1.00
R4653:Vps8	UTSW	16	21500210	missense	probably damaging	1.00
R4664:Vps8	UTSW	16	21444188	splice site	probably null
R4713:Vps8	UTSW	16	21442439	missense	probably damaging	1.00
R4726:Vps8	UTSW	16	21448404	splice site	probably null
R4959:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4973:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4975:Vps8	UTSW	16	21466469	missense	probably damaging	1.00
R4992:Vps8	UTSW	16	21461408	missense	possibly damaging	0.52
R5144:Vps8	UTSW	16	21559353	missense	probably damaging	1.00
R5168:Vps8	UTSW	16	21457445	missense	probably damaging	0.99
R5168:Vps8	UTSW	16	21533099	missense	probably benign	0.05
R5222:Vps8	UTSW	16	21581548	nonsense	probably null
R5231:Vps8	UTSW	16	21576725	missense	probably damaging	1.00
R5876:Vps8	UTSW	16	21461439	critical splice donor site	probably null
R5963:Vps8	UTSW	16	21470121	missense	possibly damaging	0.48
R6010:Vps8	UTSW	16	21545205	intron	probably benign
R6023:Vps8	UTSW	16	21461238	missense	probably benign	0.32
R6173:Vps8	UTSW	16	21495932	splice site	probably null
R6185:Vps8	UTSW	16	21470141	missense	probably damaging	0.98
R6264:Vps8	UTSW	16	21559349	nonsense	probably null
R6409:Vps8	UTSW	16	21478439	missense	probably benign	0.29
R6522:Vps8	UTSW	16	21442379	missense	probably damaging	0.99
R6528:Vps8	UTSW	16	21554125	nonsense	probably null
R6784:Vps8	UTSW	16	21563207	missense	probably benign	0.01
R7040:Vps8	UTSW	16	21575022	missense	probably damaging	1.00
R7072:Vps8	UTSW	16	21581579	missense	probably benign
R7103:Vps8	UTSW	16	21526441	missense	probably damaging	1.00
R7149:Vps8	UTSW	16	21459776	missense	probably damaging	1.00
R7195:Vps8	UTSW	16	21456282	missense	probably damaging	1.00
R7206:Vps8	UTSW	16	21457421	missense	probably damaging	1.00
R7403:Vps8	UTSW	16	21434972	missense	possibly damaging	0.78
R7782:Vps8	UTSW	16	21511558	missense	possibly damaging	0.89
R7806:Vps8	UTSW	16	21459751	missense	probably damaging	1.00
R7846:Vps8	UTSW	16	21532320	missense	probably benign	0.01
R7943:Vps8	UTSW	16	21477872	missense	possibly damaging	0.66
R8075:Vps8	UTSW	16	21521894	missense	probably damaging	0.99
R8190:Vps8	UTSW	16	21575030	missense	possibly damaging	0.73
R8307:Vps8	UTSW	16	21495902	missense	probably benign	0.02
R8483:Vps8	UTSW	16	21575013	missense	probably damaging	0.98
R8814:Vps8	UTSW	16	21576650	missense	probably damaging	1.00
R9064:Vps8	UTSW	16	21470229	missense	probably damaging	1.00
R9367:Vps8	UTSW	16	21521918	missense	possibly damaging	0.45
R9404:Vps8	UTSW	16	21608177	missense	probably benign	0.12
R9544:Vps8	UTSW	16	21518143	missense	probably benign	0.00
R9570:Vps8	UTSW	16	21644203	missense	probably benign	0.10
R9634:Vps8	UTSW	16	21554143	missense	probably damaging	1.00
R9702:Vps8	UTSW	16	21644133	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TCTTGTCCCTGAATAGCCAGCCAC -3'
(R):5'- TCAAGGGCTGAACAGGTTTCATCAC -3'

Sequencing Primer
(F):5'- CATGTGTGTGGGCTTTATACTAAGTG -3'
(R):5'- CAGTATCCATCAGGTAAACCGGAG -3'

Posted On

2014-03-28