Incidental Mutation 'R1482:Fth1'
ID164488
Institutional Source Beutler Lab
Gene Symbol Fth1
Ensembl Gene ENSMUSG00000024661
Gene Nameferritin heavy polypeptide 1
SynonymsHFt, H-ferritin, FHC, MFH
MMRRC Submission 039535-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R1482 (G1)
Quality Score193
Status Not validated
Chromosome19
Chromosomal Location9982703-9985092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 9984853 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 154 (T154A)
Ref Sequence ENSEMBL: ENSMUSP00000025563 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025563] [ENSMUST00000117346]
PDB Structure
Structure of Mouse H-chain modified ferritin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025563
AA Change: T154A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000025563
Gene: ENSMUSG00000024661
AA Change: T154A

DomainStartEndE-ValueType
Pfam:Ferritin 18 159 1.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117346
SMART Domains Protein: ENSMUSP00000113053
Gene: ENSMUSG00000037418

DomainStartEndE-ValueType
Pfam:Bestrophin 8 316 8.5e-111 PFAM
low complexity region 476 488 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos. Mice heterozygous for a knock-out allele exhibit oxidative stress in neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,717,192 D260N probably benign Het
AI314180 T C 4: 58,820,163 K1217E possibly damaging Het
Ankef1 A T 2: 136,550,158 K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Aqp6 A T 15: 99,604,307 *294C probably null Het
Baz2a T A 10: 128,109,008 M38K possibly damaging Het
Bcl2l14 A G 6: 134,427,302 D151G probably damaging Het
Cabp5 T A 7: 13,398,342 L12* probably null Het
Cachd1 T C 4: 100,988,598 V993A possibly damaging Het
Cd44 G A 2: 102,831,383 T306I probably damaging Het
Cdc20 A T 4: 118,437,056 N22K probably benign Het
Cdc6 T A 11: 98,916,981 D433E possibly damaging Het
Clhc1 A G 11: 29,553,725 D47G probably damaging Het
Csf2 T C 11: 54,248,563 K65E probably benign Het
Cul9 T C 17: 46,508,547 E2005G probably damaging Het
Dclk3 G T 9: 111,467,820 R144L possibly damaging Het
Dcpp2 C T 17: 23,900,542 T110I probably damaging Het
Disp1 A T 1: 183,086,474 F1461I possibly damaging Het
Dnah1 C T 14: 31,294,874 G1562D probably damaging Het
Exoc3l2 C A 7: 19,495,359 P234Q probably damaging Het
F2rl2 T C 13: 95,701,539 V364A probably benign Het
Fam151a T C 4: 106,745,679 L265P probably damaging Het
Fam151b T A 13: 92,450,166 Q253L probably benign Het
Fat1 G A 8: 44,953,244 V1011M probably benign Het
Fbxo6 G A 4: 148,145,984 R274* probably null Het
Fgd4 G T 16: 16,484,473 Q73K probably benign Het
Hgs C A 11: 120,480,040 H572Q probably benign Het
Kcnk10 G A 12: 98,489,948 T208I probably damaging Het
Kdm5b G A 1: 134,624,897 V1204M probably damaging Het
Keg1 A C 19: 12,718,821 H166P probably damaging Het
Kifap3 A T 1: 163,825,859 N338I possibly damaging Het
Llcfc1 A T 6: 41,685,284 D74V probably damaging Het
Lman2 A G 13: 55,351,405 V219A possibly damaging Het
Mettl25 A G 10: 105,826,590 I173T possibly damaging Het
Mov10 G T 3: 104,804,546 P170Q probably damaging Het
Mtif2 G T 11: 29,536,847 A286S probably damaging Het
Mtmr10 A G 7: 64,314,249 Y244C probably damaging Het
Nbea A T 3: 56,079,993 C359S probably damaging Het
Nbr1 C T 11: 101,572,841 T633I probably benign Het
Nepn A T 10: 52,400,416 T22S probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Oacyl T A 18: 65,737,972 L342M probably damaging Het
Olfr691 T A 7: 105,337,256 R153S probably damaging Het
Olfr699 A G 7: 106,790,333 F223L probably benign Het
Olfr775 T A 10: 129,251,143 I203N possibly damaging Het
Olfr872 G A 9: 20,260,724 V295I possibly damaging Het
Oxnad1 T C 14: 32,099,633 probably null Het
Pard3b A T 1: 62,166,367 D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 D391A possibly damaging Het
Ptprk T C 10: 28,263,516 V79A probably benign Het
Rwdd2a A G 9: 86,574,278 D169G probably damaging Het
Scn3b A C 9: 40,279,496 D74A probably damaging Het
Setbp1 C T 18: 79,086,835 D61N probably damaging Het
Setx T A 2: 29,162,992 D2089E probably damaging Het
Vmn2r69 C G 7: 85,406,874 W685C probably damaging Het
Vps8 A G 16: 21,581,598 Q1272R probably benign Het
Wnk4 T C 11: 101,269,636 F699L probably damaging Het
Zfp616 T A 11: 74,083,977 N448K possibly damaging Het
Zfp618 C A 4: 63,115,448 D307E possibly damaging Het
Zfp687 A G 3: 95,007,533 F1219S probably damaging Het
Zfpm2 T A 15: 41,099,291 D248E probably damaging Het
Other mutations in Fth1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00712:Fth1 APN 19 9984799 missense probably benign 0.01
PIT4280001:Fth1 UTSW 19 9984609 missense probably damaging 0.98
R2063:Fth1 UTSW 19 9984212 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTACTGACAAGAATGATCCCCAC -3'
(R):5'- TAACTGGCGGTGAAGCAACTGG -3'

Sequencing Primer
(F):5'- ACGTGAGTATCGGAAACGTG -3'
(R):5'- ACTGGAAGCTGGAATGCTTATCC -3'
Posted On2014-03-28