Incidental Mutation 'R1482:Keg1'
ID 164489
Institutional Source Beutler Lab
Gene Symbol Keg1
Ensembl Gene ENSMUSG00000024694
Gene Name kidney expressed gene 1
Synonyms 0610008P16Rik, GS4059
MMRRC Submission 039535-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.087) question?
Stock # R1482 (G1)
Quality Score 222
Status Not validated
Chromosome 19
Chromosomal Location 12673154-12697266 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 12696185 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 166 (H166P)
Ref Sequence ENSEMBL: ENSMUSP00000116555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025598] [ENSMUST00000138545] [ENSMUST00000154822]
AlphaFold Q9DCY0
Predicted Effect probably damaging
Transcript: ENSMUST00000025598
AA Change: H176P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025598
Gene: ENSMUSG00000024694
AA Change: H176P

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 205 1.2e-89 PFAM
Pfam:Gly_acyl_tr_C 206 294 1.9e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125496
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128987
Predicted Effect probably damaging
Transcript: ENSMUST00000138545
AA Change: H166P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116555
Gene: ENSMUSG00000024694
AA Change: H166P

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 195 4.2e-96 PFAM
Pfam:Gly_acyl_tr_C 196 228 4.3e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147335
Predicted Effect probably benign
Transcript: ENSMUST00000154822
SMART Domains Protein: ENSMUSP00000119879
Gene: ENSMUSG00000024694

DomainStartEndE-ValueType
Pfam:Gly_acyl_tr_N 1 156 1.2e-71 PFAM
Pfam:Gly_acyl_tr_C 153 221 3.2e-37 PFAM
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 93.8%
  • 20x: 83.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810055G02Rik G A 19: 3,767,192 (GRCm39) D260N probably benign Het
Ankef1 A T 2: 136,392,078 (GRCm39) K422N possibly damaging Het
Anxa2 TCCC TCC 9: 69,397,036 (GRCm39) probably null Het
Aqp6 A T 15: 99,502,188 (GRCm39) *294C probably null Het
Baz2a T A 10: 127,944,877 (GRCm39) M38K possibly damaging Het
Bcl2l14 A G 6: 134,404,265 (GRCm39) D151G probably damaging Het
Cabp5 T A 7: 13,132,267 (GRCm39) L12* probably null Het
Cachd1 T C 4: 100,845,795 (GRCm39) V993A possibly damaging Het
Cd44 G A 2: 102,661,728 (GRCm39) T306I probably damaging Het
Cdc20 A T 4: 118,294,253 (GRCm39) N22K probably benign Het
Cdc6 T A 11: 98,807,807 (GRCm39) D433E possibly damaging Het
Clhc1 A G 11: 29,503,725 (GRCm39) D47G probably damaging Het
Csf2 T C 11: 54,139,389 (GRCm39) K65E probably benign Het
Cul9 T C 17: 46,819,473 (GRCm39) E2005G probably damaging Het
Dclk3 G T 9: 111,296,888 (GRCm39) R144L possibly damaging Het
Dcpp2 C T 17: 24,119,516 (GRCm39) T110I probably damaging Het
Disp1 A T 1: 182,868,038 (GRCm39) F1461I possibly damaging Het
Dnah1 C T 14: 31,016,831 (GRCm39) G1562D probably damaging Het
Ecpas T C 4: 58,820,163 (GRCm39) K1217E possibly damaging Het
Exoc3l2 C A 7: 19,229,284 (GRCm39) P234Q probably damaging Het
F2rl2 T C 13: 95,838,047 (GRCm39) V364A probably benign Het
Fam151a T C 4: 106,602,876 (GRCm39) L265P probably damaging Het
Fam151b T A 13: 92,586,674 (GRCm39) Q253L probably benign Het
Fat1 G A 8: 45,406,281 (GRCm39) V1011M probably benign Het
Fbxo6 G A 4: 148,230,441 (GRCm39) R274* probably null Het
Fgd4 G T 16: 16,302,337 (GRCm39) Q73K probably benign Het
Fth1 A G 19: 9,962,217 (GRCm39) T154A probably benign Het
Hgs C A 11: 120,370,866 (GRCm39) H572Q probably benign Het
Kcnk10 G A 12: 98,456,207 (GRCm39) T208I probably damaging Het
Kdm5b G A 1: 134,552,635 (GRCm39) V1204M probably damaging Het
Kifap3 A T 1: 163,653,428 (GRCm39) N338I possibly damaging Het
Llcfc1 A T 6: 41,662,218 (GRCm39) D74V probably damaging Het
Lman2 A G 13: 55,499,218 (GRCm39) V219A possibly damaging Het
Mettl25 A G 10: 105,662,451 (GRCm39) I173T possibly damaging Het
Mov10 G T 3: 104,711,862 (GRCm39) P170Q probably damaging Het
Mtif2 G T 11: 29,486,847 (GRCm39) A286S probably damaging Het
Mtmr10 A G 7: 63,963,997 (GRCm39) Y244C probably damaging Het
Nbea A T 3: 55,987,414 (GRCm39) C359S probably damaging Het
Nbr1 C T 11: 101,463,667 (GRCm39) T633I probably benign Het
Nepn A T 10: 52,276,512 (GRCm39) T22S probably damaging Het
Nup214 C T 2: 31,924,478 (GRCm39) S1669F probably damaging Het
Oacyl T A 18: 65,871,043 (GRCm39) L342M probably damaging Het
Or2ag17 A G 7: 106,389,540 (GRCm39) F223L probably benign Het
Or52b2 T A 7: 104,986,463 (GRCm39) R153S probably damaging Het
Or6c205 T A 10: 129,087,012 (GRCm39) I203N possibly damaging Het
Or7e176 G A 9: 20,172,020 (GRCm39) V295I possibly damaging Het
Oxnad1 T C 14: 31,821,590 (GRCm39) probably null Het
Pard3b A T 1: 62,205,526 (GRCm39) D440V probably damaging Het
Pou3f2 T G 4: 22,486,960 (GRCm39) D391A possibly damaging Het
Ptprk T C 10: 28,139,512 (GRCm39) V79A probably benign Het
Rwdd2a A G 9: 86,456,331 (GRCm39) D169G probably damaging Het
Scn3b A C 9: 40,190,792 (GRCm39) D74A probably damaging Het
Setbp1 C T 18: 79,130,050 (GRCm39) D61N probably damaging Het
Setx T A 2: 29,053,004 (GRCm39) D2089E probably damaging Het
Vmn2r69 C G 7: 85,056,082 (GRCm39) W685C probably damaging Het
Vps8 A G 16: 21,400,348 (GRCm39) Q1272R probably benign Het
Wnk4 T C 11: 101,160,462 (GRCm39) F699L probably damaging Het
Zfp616 T A 11: 73,974,803 (GRCm39) N448K possibly damaging Het
Zfp618 C A 4: 63,033,685 (GRCm39) D307E possibly damaging Het
Zfp687 A G 3: 94,914,844 (GRCm39) F1219S probably damaging Het
Zfpm2 T A 15: 40,962,687 (GRCm39) D248E probably damaging Het
Other mutations in Keg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Keg1 APN 19 12,696,364 (GRCm39) missense probably damaging 1.00
IGL01084:Keg1 APN 19 12,691,976 (GRCm39) missense probably damaging 1.00
IGL02563:Keg1 APN 19 12,696,521 (GRCm39) missense probably damaging 1.00
IGL03328:Keg1 APN 19 12,696,461 (GRCm39) missense probably damaging 1.00
R0103:Keg1 UTSW 19 12,696,280 (GRCm39) missense possibly damaging 0.79
R0103:Keg1 UTSW 19 12,696,280 (GRCm39) missense possibly damaging 0.79
R0417:Keg1 UTSW 19 12,688,424 (GRCm39) missense probably damaging 1.00
R1300:Keg1 UTSW 19 12,696,368 (GRCm39) missense probably damaging 0.98
R1476:Keg1 UTSW 19 12,693,387 (GRCm39) missense probably benign
R1643:Keg1 UTSW 19 12,696,406 (GRCm39) missense probably benign 0.00
R4002:Keg1 UTSW 19 12,696,307 (GRCm39) missense possibly damaging 0.95
R5022:Keg1 UTSW 19 12,696,521 (GRCm39) missense probably damaging 1.00
R5164:Keg1 UTSW 19 12,692,044 (GRCm39) intron probably benign
R5386:Keg1 UTSW 19 12,691,902 (GRCm39) missense probably damaging 1.00
R6289:Keg1 UTSW 19 12,691,937 (GRCm39) missense probably damaging 0.98
R6517:Keg1 UTSW 19 12,693,274 (GRCm39) missense probably benign 0.00
R6656:Keg1 UTSW 19 12,686,994 (GRCm39) nonsense probably null
R7117:Keg1 UTSW 19 12,687,042 (GRCm39) missense probably damaging 1.00
R7676:Keg1 UTSW 19 12,693,409 (GRCm39) missense probably benign 0.00
R7807:Keg1 UTSW 19 12,691,998 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGGATTGGAATCCCGACCACAC -3'
(R):5'- TGTCTGAATCTGCTGGGAAGCAAC -3'

Sequencing Primer
(F):5'- cacacacacacacacacac -3'
(R):5'- CAACATGGTAAATGAGACTCTGGC -3'
Posted On 2014-03-28