Mutagenetix > Incidental Mutation

Incidental Mutation 'R1195:Cntnap2'

164503

Institutional Source

Beutler Lab

Gene Symbol

Cntnap2

Ensembl Gene

ENSMUSG00000039419

Gene Name

contactin associated protein-like 2

Synonyms

5430425M22Rik, Caspr2

MMRRC Submission

039267-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1195 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

45059357-47304213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46483968 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 646 (M646K)

Ref Sequence

ENSEMBL: ENSMUSP00000110288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114641]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114641
AA Change: M646K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000110288
Gene: ENSMUSG00000039419
AA Change: M646K

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	34	181	3.99e-22	SMART
LamG	208	345	5.5e-34	SMART
LamG	393	529	3.31e-28	SMART
EGF	557	591	5.04e-2	SMART
Blast:FBG	594	777	7e-68	BLAST
LamG	819	945	5.58e-35	SMART
EGF	966	1002	2.11e1	SMART
LamG	1048	1188	3.55e-28	SMART
low complexity region	1263	1273	N/A	INTRINSIC
4.1m	1283	1301	4.21e-7	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000158913

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203319

Meta Mutation Damage Score

0.0743

Coding Region Coverage

1x: 99.7%
3x: 98.6%
10x: 92.8%
20x: 76.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin family which functions in the vertebrate nervous system as cell adhesion molecules and receptors. This protein, like other neurexin proteins, contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, thrombospondin N-terminal-like domains and a putative PDZ binding site. This protein is localized at the juxtaparanodes of myelinated axons, and mediates interactions between neurons and glia during nervous system development and is also involved in localization of potassium channels within differentiating axons. This gene encompasses almost 1.5% of chromosome 7 and is one of the largest genes in the human genome. It is directly bound and regulated by forkhead box protein P2 (FOXP2), a transcription factor related to speech and language development. This gene has been implicated in multiple neurodevelopmental disorders, including Gilles de la Tourette syndrome, schizophrenia, epilepsy, autism, ADHD and mental retardation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Inactivation of this gene results in molecular abnormalities within the central nervous system, but homozygous mutant mice show no overt phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AC073561.5	A	T	12: 114,479,395		probably benign	Het
Agtr1a	C	A	13: 30,381,918	P322Q	probably damaging	Het
Brd1	T	C	15: 88,700,811	E940G	probably benign	Het
Cd163	T	A	6: 124,325,250		probably benign	Het
Cd28	C	T	1: 60,763,144	T74I	possibly damaging	Het
Cyb5d1	C	T	11: 69,394,971		probably null	Het
D430042O09Rik	A	G	7: 125,866,482	R1343G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dab2ip	T	C	2: 35,718,745		probably benign	Het
Dst	A	G	1: 34,211,154	D4063G	probably damaging	Het
Elmod1	T	C	9: 53,935,768	Y42C	probably damaging	Het
Fam129b	T	C	2: 32,919,803	V304A	probably benign	Het
Hdac5	T	C	11: 102,205,506	I310V	probably damaging	Het
Hpx	A	G	7: 105,599,649		probably benign	Het
Igsf3	A	G	3: 101,458,103	D1130G	probably benign	Het
Kdm4d	A	G	9: 14,463,099	S488P	probably benign	Het
Lingo2	A	G	4: 35,708,538	Y481H	probably damaging	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Map3k20	C	T	2: 72,438,218	P523L	probably damaging	Het
Myo9a	A	G	9: 59,895,200	D1990G	probably damaging	Het
Perp	C	A	10: 18,855,735	Y147*	probably null	Het
Prr16	A	T	18: 51,302,683	D78V	probably damaging	Het
Rfx7	C	T	9: 72,617,946	T806M	probably damaging	Het
Robo2	T	C	16: 73,916,128		probably null	Het
Spdl1	T	C	11: 34,819,817	Y368C	probably damaging	Het
Sptbn2	G	C	19: 4,745,893	R1700P	possibly damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tln2	T	G	9: 67,258,566	K1000Q	probably damaging	Het
Tmbim7	A	G	5: 3,661,943	T63A	probably benign	Het
Tmed11	T	C	5: 108,779,019	D129G	possibly damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Ttll6	T	C	11: 96,135,729	I113T	probably damaging	Het
Uso1	T	A	5: 92,170,747	F210L	probably damaging	Het
Uspl1	T	A	5: 149,194,321	V224E	probably benign	Het
Zfp639	G	A	3: 32,519,196	V86I	possibly damaging	Het

Other mutations in Cntnap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Cntnap2	APN	6	46015263	missense	possibly damaging	0.92
IGL00657:Cntnap2	APN	6	46988787	missense	probably damaging	0.98
IGL00846:Cntnap2	APN	6	47193038	missense	probably benign	0.12
IGL00851:Cntnap2	APN	6	46484072	missense	probably benign
IGL00857:Cntnap2	APN	6	47049424	missense	probably benign	0.00
IGL01290:Cntnap2	APN	6	46015465	missense	probably benign	0.06
IGL01445:Cntnap2	APN	6	47193013	missense	probably benign	0.14
IGL01468:Cntnap2	APN	6	47271371	nonsense	probably null
IGL01859:Cntnap2	APN	6	46988721	missense	probably damaging	1.00
IGL02092:Cntnap2	APN	6	46234203	missense	probably damaging	1.00
IGL02239:Cntnap2	APN	6	47021654	missense	probably damaging	0.99
IGL02508:Cntnap2	APN	6	46234320	missense	probably damaging	1.00
IGL02530:Cntnap2	APN	6	47021736	missense	possibly damaging	0.48
IGL03013:Cntnap2	APN	6	47095549	missense	possibly damaging	0.66
BB004:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
BB014:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
IGL02802:Cntnap2	UTSW	6	46170245	missense	probably damaging	1.00
R0001:Cntnap2	UTSW	6	46530171	missense	probably benign	0.04
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0007:Cntnap2	UTSW	6	45992073	missense	possibly damaging	0.95
R0043:Cntnap2	UTSW	6	46483983	missense	probably benign	0.01
R0118:Cntnap2	UTSW	6	45060392	splice site	probably null
R0352:Cntnap2	UTSW	6	45992084	splice site	probably null
R0389:Cntnap2	UTSW	6	46009637	missense	probably benign	0.06
R0482:Cntnap2	UTSW	6	45715816	missense	probably benign	0.00
R0530:Cntnap2	UTSW	6	46529905	nonsense	probably null
R0611:Cntnap2	UTSW	6	47095549	missense	possibly damaging	0.66
R0630:Cntnap2	UTSW	6	46988760	missense	probably damaging	0.99
R0636:Cntnap2	UTSW	6	47296708	splice site	probably benign
R0976:Cntnap2	UTSW	6	47271230	missense	probably damaging	1.00
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1195:Cntnap2	UTSW	6	46483968	missense	probably benign
R1387:Cntnap2	UTSW	6	47107914	missense	probably benign	0.19
R1524:Cntnap2	UTSW	6	46530679	missense	probably damaging	1.00
R1609:Cntnap2	UTSW	6	46015330	missense	probably benign	0.13
R1716:Cntnap2	UTSW	6	47107892	nonsense	probably null
R1757:Cntnap2	UTSW	6	46759829	missense	probably damaging	1.00
R1809:Cntnap2	UTSW	6	46988675	missense	probably damaging	0.99
R1813:Cntnap2	UTSW	6	46530633	missense	probably damaging	1.00
R2103:Cntnap2	UTSW	6	47298588	missense	probably damaging	1.00
R2133:Cntnap2	UTSW	6	47298445	missense	probably damaging	1.00
R3037:Cntnap2	UTSW	6	46015266	missense	possibly damaging	0.57
R3899:Cntnap2	UTSW	6	45991903	missense	probably benign	0.00
R4027:Cntnap2	UTSW	6	46856128	missense	probably benign
R4030:Cntnap2	UTSW	6	46856128	missense	probably benign
R4237:Cntnap2	UTSW	6	46530390	intron	probably benign
R4445:Cntnap2	UTSW	6	46759851	missense	probably benign	0.01
R4737:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4740:Cntnap2	UTSW	6	45060317	missense	possibly damaging	0.65
R4915:Cntnap2	UTSW	6	46530035	intron	probably benign
R4918:Cntnap2	UTSW	6	46530035	intron	probably benign
R4999:Cntnap2	UTSW	6	45920834	missense	probably damaging	0.96
R5373:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5374:Cntnap2	UTSW	6	47107969	missense	probably benign	0.00
R5742:Cntnap2	UTSW	6	45920926	nonsense	probably null
R5748:Cntnap2	UTSW	6	45715884	missense	probably damaging	1.00
R5765:Cntnap2	UTSW	6	46529815	intron	probably benign
R6118:Cntnap2	UTSW	6	47193077	missense	possibly damaging	0.81
R6181:Cntnap2	UTSW	6	46759808	missense	probably damaging	1.00
R6189:Cntnap2	UTSW	6	47271298	missense	probably damaging	1.00
R6262:Cntnap2	UTSW	6	45060112	splice site	probably null
R6385:Cntnap2	UTSW	6	46856180	missense	probably benign	0.00
R6555:Cntnap2	UTSW	6	46759760	missense	probably damaging	1.00
R6577:Cntnap2	UTSW	6	46170272	missense	probably benign	0.25
R6610:Cntnap2	UTSW	6	46015257	missense	probably benign	0.08
R6761:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R7125:Cntnap2	UTSW	6	46988646	missense	probably benign	0.12
R7329:Cntnap2	UTSW	6	47271271	missense	possibly damaging	0.94
R7502:Cntnap2	UTSW	6	46484029	missense	possibly damaging	0.83
R7927:Cntnap2	UTSW	6	47095687	missense	possibly damaging	0.93
R8057:Cntnap2	UTSW	6	46347145	missense	probably damaging	0.98
R8261:Cntnap2	UTSW	6	47095693	missense	probably damaging	0.98
R8356:Cntnap2	UTSW	6	47049373	missense	probably benign	0.03
R8479:Cntnap2	UTSW	6	46759773	missense	probably benign	0.14
R8503:Cntnap2	UTSW	6	45992041	missense	probably damaging	1.00
R8698:Cntnap2	UTSW	6	47049222	missense	probably damaging	1.00
R8719:Cntnap2	UTSW	6	46001227	missense	probably damaging	1.00
R8816:Cntnap2	UTSW	6	46856142	missense	possibly damaging	0.72
R8987:Cntnap2	UTSW	6	46484049	missense	probably benign	0.01
R9000:Cntnap2	UTSW	6	46484205	intron	probably benign
R9209:Cntnap2	UTSW	6	47049249	missense	probably damaging	1.00
R9253:Cntnap2	UTSW	6	46001178	missense	probably benign	0.00
R9310:Cntnap2	UTSW	6	46001347	missense	probably damaging	1.00
R9395:Cntnap2	UTSW	6	46001310	missense	probably damaging	0.98
R9462:Cntnap2	UTSW	6	46234283	missense	probably damaging	0.99
R9526:Cntnap2	UTSW	6	46015231	missense	probably damaging	1.00
R9600:Cntnap2	UTSW	6	45992075	missense	probably damaging	0.98
R9621:Cntnap2	UTSW	6	46988792	missense	probably damaging	0.98
R9738:Cntnap2	UTSW	6	46015439	frame shift	probably null
R9745:Cntnap2	UTSW	6	46234166	missense	probably benign	0.01
R9775:Cntnap2	UTSW	6	47049327	missense	probably damaging	1.00
RF022:Cntnap2	UTSW	6	47021665	missense	probably damaging	1.00
X0018:Cntnap2	UTSW	6	46009518	missense	possibly damaging	0.53
X0063:Cntnap2	UTSW	6	47021754	missense	possibly damaging	0.92
X0066:Cntnap2	UTSW	6	46234245	missense	probably benign	0.03
Z1176:Cntnap2	UTSW	6	47271148	missense	probably benign	0.00
Z1177:Cntnap2	UTSW	6	46015299	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- ACTGTCGGGATTGCTCCCTCTAAC -3'
(R):5'- GCACATTGAGGACTGAAGACTGGAC -3'

Sequencing Primer
(F):5'- AACTCGGTTTTATTCCAGTCTAATG -3'
(R):5'- TAATAAGCCACACCTGTTGGG -3'

Posted On

2014-03-28