Mutagenetix > Incidental Mutations

Incidental Mutation 'R1195:Spdl1'

164514

Institutional Source

Beutler Lab

Gene Symbol

Spdl1

Ensembl Gene

ENSMUSG00000069910

Gene Name

spindle apparatus coiled-coil protein 1

Synonyms

MMRRC Submission

039267-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.858) question?

Stock #

R1195 (G1)

Quality Score

199

Status

Not validated

Chromosome

Chromosomal Location

34809190-34833641 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 34819817 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 368 (Y368C)

Ref Sequence

ENSEMBL: ENSMUSP00000090882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093191]

Predicted Effect

probably damaging
Transcript: ENSMUST00000093191
AA Change: Y368C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910
AA Change: Y368C

Domain	Start	End	E-Value	Type
coiled coil region	35	342	N/A	INTRINSIC
coiled coil region	370	441	N/A	INTRINSIC
low complexity region	463	478	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148853

Meta Mutation Damage Score

0.1510

Coding Region Coverage

1x: 99.7%
3x: 98.6%
10x: 92.8%
20x: 76.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
AC073561.5	A	T	12: 114,479,395		probably benign	Het
Agtr1a	C	A	13: 30,381,918	P322Q	probably damaging	Het
Brd1	T	C	15: 88,700,811	E940G	probably benign	Het
Cd163	T	A	6: 124,325,250		probably benign	Het
Cd28	C	T	1: 60,763,144	T74I	possibly damaging	Het
Cntnap2	T	A	6: 46,483,968	M646K	probably benign	Het
Cyb5d1	C	T	11: 69,394,971		probably null	Het
D430042O09Rik	A	G	7: 125,866,482	R1343G	probably damaging	Het
D6Ertd527e	C	G	6: 87,111,524	T223S	unknown	Het
Dab2ip	T	C	2: 35,718,745		probably benign	Het
Dst	A	G	1: 34,211,154	D4063G	probably damaging	Het
Elmod1	T	C	9: 53,935,768	Y42C	probably damaging	Het
Fam129b	T	C	2: 32,919,803	V304A	probably benign	Het
Hdac5	T	C	11: 102,205,506	I310V	probably damaging	Het
Hpx	A	G	7: 105,599,649		probably benign	Het
Igsf3	A	G	3: 101,458,103	D1130G	probably benign	Het
Kdm4d	A	G	9: 14,463,099	S488P	probably benign	Het
Lingo2	A	G	4: 35,708,538	Y481H	probably damaging	Het
Ltbp1	A	G	17: 75,225,285	Q118R	possibly damaging	Het
Map3k20	C	T	2: 72,438,218	P523L	probably damaging	Het
Myo9a	A	G	9: 59,895,200	D1990G	probably damaging	Het
Perp	C	A	10: 18,855,735	Y147*	probably null	Het
Prr16	A	T	18: 51,302,683	D78V	probably damaging	Het
Rfx7	C	T	9: 72,617,946	T806M	probably damaging	Het
Robo2	T	C	16: 73,916,128		probably null	Het
Sptbn2	G	C	19: 4,745,893	R1700P	possibly damaging	Het
Tenm2	C	T	11: 36,063,177	G1236R	possibly damaging	Het
Tln2	T	G	9: 67,258,566	K1000Q	probably damaging	Het
Tmbim7	A	G	5: 3,661,943	T63A	probably benign	Het
Tmed11	T	C	5: 108,779,019	D129G	possibly damaging	Het
Ttc28	G	A	5: 111,225,677	S962N	probably damaging	Het
Ttll6	T	C	11: 96,135,729	I113T	probably damaging	Het
Uso1	T	A	5: 92,170,747	F210L	probably damaging	Het
Uspl1	T	A	5: 149,194,321	V224E	probably benign	Het
Zfp639	G	A	3: 32,519,196	V86I	possibly damaging	Het

Other mutations in Spdl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02417:Spdl1	APN	11	34813354	missense	probably benign	0.27
IGL02694:Spdl1	APN	11	34813621	missense	probably benign	0.05
IGL03131:Spdl1	APN	11	34830765	missense	possibly damaging	0.46
R0295:Spdl1	UTSW	11	34813343	missense	possibly damaging	0.82
R0319:Spdl1	UTSW	11	34823520	missense	possibly damaging	0.66
R1017:Spdl1	UTSW	11	34819290	missense	possibly damaging	0.66
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1195:Spdl1	UTSW	11	34819817	missense	probably damaging	0.97
R1296:Spdl1	UTSW	11	34813607	missense	unknown
R1315:Spdl1	UTSW	11	34813407	missense	unknown
R1799:Spdl1	UTSW	11	34821029	nonsense	probably null
R2002:Spdl1	UTSW	11	34822646	missense	probably benign
R2291:Spdl1	UTSW	11	34819309	nonsense	probably null
R4771:Spdl1	UTSW	11	34813327	missense	probably damaging	0.98
R5030:Spdl1	UTSW	11	34823440	missense	probably benign	0.00
R5167:Spdl1	UTSW	11	34813360	missense	possibly damaging	0.79
R5477:Spdl1	UTSW	11	34822210	missense	possibly damaging	0.66
R6258:Spdl1	UTSW	11	34819886	missense	probably damaging	0.97
R6260:Spdl1	UTSW	11	34819886	missense	probably damaging	0.97
R6554:Spdl1	UTSW	11	34822570	missense	possibly damaging	0.82
R6695:Spdl1	UTSW	11	34823003	intron	probably null
R6714:Spdl1	UTSW	11	34823003	intron	probably null
R6980:Spdl1	UTSW	11	34830879	start codon destroyed	probably null	0.04
R7355:Spdl1	UTSW	11	34823364	missense	not run
R7791:Spdl1	UTSW	11	34813477	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- AACAGTTTCCGCTCAATATCCAGGG -3'
(R):5'- AGGAGCATCTACTTAGTGGTGGCAG -3'

Sequencing Primer
(F):5'- ACCTTGCGTGTTAAAAAGGC -3'
(R):5'- TATGGAATCGAGGCCTTCCAC -3'

Posted On

2014-03-28