Incidental Mutation 'R1195:Spdl1'
ID164514
Institutional Source Beutler Lab
Gene Symbol Spdl1
Ensembl Gene ENSMUSG00000069910
Gene Namespindle apparatus coiled-coil protein 1
Synonyms
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.858) question?
Stock #R1195 (G1)
Quality Score199
Status Not validated
Chromosome11
Chromosomal Location34809190-34833641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34819817 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 368 (Y368C)
Ref Sequence ENSEMBL: ENSMUSP00000090882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093191]
Predicted Effect probably damaging
Transcript: ENSMUST00000093191
AA Change: Y368C

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090882
Gene: ENSMUSG00000069910
AA Change: Y368C

DomainStartEndE-ValueType
coiled coil region 35 342 N/A INTRINSIC
coiled coil region 370 441 N/A INTRINSIC
low complexity region 463 478 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148853
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 92.8%
  • 20x: 76.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain-containing protein that functions in mitotic spindle formation and chromosome segregation. The encoded protein plays a role in coordinating microtubule attachment by promoting recruitment of dynein proteins, and in mitotic checkpoint signaling. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC073561.5 A T 12: 114,479,395 probably benign Het
Agtr1a C A 13: 30,381,918 P322Q probably damaging Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd163 T A 6: 124,325,250 probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dab2ip T C 2: 35,718,745 probably benign Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Hpx A G 7: 105,599,649 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Spdl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02417:Spdl1 APN 11 34813354 missense probably benign 0.27
IGL02694:Spdl1 APN 11 34813621 missense probably benign 0.05
IGL03131:Spdl1 APN 11 34830765 missense possibly damaging 0.46
R0295:Spdl1 UTSW 11 34813343 missense possibly damaging 0.82
R0319:Spdl1 UTSW 11 34823520 missense possibly damaging 0.66
R1017:Spdl1 UTSW 11 34819290 missense possibly damaging 0.66
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1195:Spdl1 UTSW 11 34819817 missense probably damaging 0.97
R1296:Spdl1 UTSW 11 34813607 missense unknown
R1315:Spdl1 UTSW 11 34813407 missense unknown
R1799:Spdl1 UTSW 11 34821029 nonsense probably null
R2002:Spdl1 UTSW 11 34822646 missense probably benign
R2291:Spdl1 UTSW 11 34819309 nonsense probably null
R4771:Spdl1 UTSW 11 34813327 missense probably damaging 0.98
R5030:Spdl1 UTSW 11 34823440 missense probably benign 0.00
R5167:Spdl1 UTSW 11 34813360 missense possibly damaging 0.79
R5477:Spdl1 UTSW 11 34822210 missense possibly damaging 0.66
R6258:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6260:Spdl1 UTSW 11 34819886 missense probably damaging 0.97
R6554:Spdl1 UTSW 11 34822570 missense possibly damaging 0.82
R6695:Spdl1 UTSW 11 34823003 intron probably null
R6714:Spdl1 UTSW 11 34823003 intron probably null
R6980:Spdl1 UTSW 11 34830879 start codon destroyed probably null 0.04
R7355:Spdl1 UTSW 11 34823364 missense not run
R7791:Spdl1 UTSW 11 34813477 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AACAGTTTCCGCTCAATATCCAGGG -3'
(R):5'- AGGAGCATCTACTTAGTGGTGGCAG -3'

Sequencing Primer
(F):5'- ACCTTGCGTGTTAAAAAGGC -3'
(R):5'- TATGGAATCGAGGCCTTCCAC -3'
Posted On2014-03-28