Incidental Mutation 'R1195:Agtr1a'
ID164520
Institutional Source Beutler Lab
Gene Symbol Agtr1a
Ensembl Gene ENSMUSG00000049115
Gene Nameangiotensin II receptor, type 1a
SynonymsAngtr-1a, Agtr1a, Agtr-1a, 1810074K20Rik, AT1, AT1a
MMRRC Submission 039267-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1195 (G1)
Quality Score222
Status Not validated
Chromosome13
Chromosomal Location30336441-30382867 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 30381918 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 322 (P322Q)
Ref Sequence ENSEMBL: ENSMUSP00000070958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066412] [ENSMUST00000221743] [ENSMUST00000222370] [ENSMUST00000222503] [ENSMUST00000223201]
Predicted Effect probably damaging
Transcript: ENSMUST00000066412
AA Change: P322Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070958
Gene: ENSMUSG00000049115
AA Change: P322Q

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 39 316 8.2e-10 PFAM
Pfam:7tm_1 45 302 1.8e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221743
Predicted Effect probably benign
Transcript: ENSMUST00000222370
Predicted Effect probably benign
Transcript: ENSMUST00000222503
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222575
Predicted Effect probably benign
Transcript: ENSMUST00000223201
Meta Mutation Damage Score 0.3675 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 98.6%
  • 10x: 92.8%
  • 20x: 76.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Angiotensin II is a potent vasopressor hormone and a primary regulator of aldosterone secretion. It is an important effector controlling blood pressure and volume in the cardiovascular system. It acts through at least two types of receptors. This gene encodes the type 1 receptor which is thought to mediate the major cardiovascular effects of angiotensin II. This gene may play a role in the generation of reperfusion arrhythmias following restoration of blood flow to ischemic or infarcted myocardium. It was previously thought that a related gene, denoted as AGTR1B, existed; however, it is now believed that there is only one type 1 receptor gene in humans. Multiple alternatively spliced transcript variants have been reported for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous inactivation of this gene causes hypotension and hyperreninemia, alters drinking behavior and vascular and hemodynamic responses to angiotensin II, and may lead to abnormal physiological response to xenobiotics, abnormal kidney morphology, andreduced cell numbers in specific brain areas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AC073561.5 A T 12: 114,479,395 probably benign Het
Brd1 T C 15: 88,700,811 E940G probably benign Het
Cd163 T A 6: 124,325,250 probably benign Het
Cd28 C T 1: 60,763,144 T74I possibly damaging Het
Cntnap2 T A 6: 46,483,968 M646K probably benign Het
Cyb5d1 C T 11: 69,394,971 probably null Het
D430042O09Rik A G 7: 125,866,482 R1343G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Dab2ip T C 2: 35,718,745 probably benign Het
Dst A G 1: 34,211,154 D4063G probably damaging Het
Elmod1 T C 9: 53,935,768 Y42C probably damaging Het
Fam129b T C 2: 32,919,803 V304A probably benign Het
Hdac5 T C 11: 102,205,506 I310V probably damaging Het
Hpx A G 7: 105,599,649 probably benign Het
Igsf3 A G 3: 101,458,103 D1130G probably benign Het
Kdm4d A G 9: 14,463,099 S488P probably benign Het
Lingo2 A G 4: 35,708,538 Y481H probably damaging Het
Ltbp1 A G 17: 75,225,285 Q118R possibly damaging Het
Map3k20 C T 2: 72,438,218 P523L probably damaging Het
Myo9a A G 9: 59,895,200 D1990G probably damaging Het
Perp C A 10: 18,855,735 Y147* probably null Het
Prr16 A T 18: 51,302,683 D78V probably damaging Het
Rfx7 C T 9: 72,617,946 T806M probably damaging Het
Robo2 T C 16: 73,916,128 probably null Het
Spdl1 T C 11: 34,819,817 Y368C probably damaging Het
Sptbn2 G C 19: 4,745,893 R1700P possibly damaging Het
Tenm2 C T 11: 36,063,177 G1236R possibly damaging Het
Tln2 T G 9: 67,258,566 K1000Q probably damaging Het
Tmbim7 A G 5: 3,661,943 T63A probably benign Het
Tmed11 T C 5: 108,779,019 D129G possibly damaging Het
Ttc28 G A 5: 111,225,677 S962N probably damaging Het
Ttll6 T C 11: 96,135,729 I113T probably damaging Het
Uso1 T A 5: 92,170,747 F210L probably damaging Het
Uspl1 T A 5: 149,194,321 V224E probably benign Het
Zfp639 G A 3: 32,519,196 V86I possibly damaging Het
Other mutations in Agtr1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Agtr1a APN 13 30381828 missense probably damaging 1.00
IGL01738:Agtr1a APN 13 30381038 missense probably benign 0.00
IGL01870:Agtr1a APN 13 30381327 missense probably damaging 1.00
IGL02293:Agtr1a APN 13 30381357 missense probably benign
IGL03411:Agtr1a APN 13 30381599 missense possibly damaging 0.49
R0012:Agtr1a UTSW 13 30381749 missense probably damaging 0.99
R0148:Agtr1a UTSW 13 30381944 missense probably benign 0.33
R0584:Agtr1a UTSW 13 30381034 missense probably damaging 1.00
R0622:Agtr1a UTSW 13 30381681 missense probably benign 0.00
R0730:Agtr1a UTSW 13 30381296 missense probably damaging 1.00
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R1195:Agtr1a UTSW 13 30381918 missense probably damaging 0.99
R4075:Agtr1a UTSW 13 30381834 missense probably damaging 1.00
R4757:Agtr1a UTSW 13 30381859 nonsense probably null
R5677:Agtr1a UTSW 13 30381584 missense probably damaging 1.00
R5722:Agtr1a UTSW 13 30382033 makesense probably null
R6355:Agtr1a UTSW 13 30381499 missense probably benign 0.04
R6633:Agtr1a UTSW 13 30381467 missense probably benign 0.01
R7325:Agtr1a UTSW 13 30381907 missense possibly damaging 0.86
R7358:Agtr1a UTSW 13 30380979 missense probably benign 0.05
R7465:Agtr1a UTSW 13 30381981 missense probably benign 0.03
X0025:Agtr1a UTSW 13 30381468 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GGAATTCAACGCTCCCCATAGGAC -3'
(R):5'- TCAGGGCATTACATTGCCAGCAAG -3'

Sequencing Primer
(F):5'- AAGAACATCCTGGGCTTCCTG -3'
(R):5'- TTGCCAGCAAGCTTTGAAC -3'
Posted On2014-03-28